Rmu_sc0002105.1_g000020

phospholipase D

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002105.1
Physical Location & Seq
Forward (+)
70970 .. 71248
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002105.1_g000020.1.cds

Sequence Viewer

Length: 279 bp
atgtctctttgggctgagcacctcggtggagttgaggatacttttaaagaccctgaaagccttgaatgcactaagcgtgtttgtgagattgccaaacaaaactggaatcaatttgtagcccaagagcatcgggagttgaagggacacttgatgcagtacccaattcaaattggtagagatggaaatgtgtcttccataccaggaattgaatcatttcctgatgttggtgggaaaattctcggggcacccaccaatcttcctgatgttctaacaacataa

Protein Analysis

92

Amino Acids

10.19

Weight (kDa)

5.0

Isoelectric Point (pI)

44.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 244
AcsI RAATTY 1 cut(s) 234
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 4 cut(s) 65, 139, 167, 209
AjnI CCWGG 1 cut(s) 199
AleI CACNNNNGTG 1 cut(s) 24
Alw21I GWGCWC 1 cut(s) 21
Alw26I GTCTC 1 cut(s) 9
Ama87I CYCGRG 1 cut(s) 239
ApoI RAATTY 1 cut(s) 234
Asp700I GAANNNNTTC 1 cut(s) 213
AvaI CYCGRG 1 cut(s) 239
BaeGI GKGCMC 1 cut(s) 247
BanI GGYRCC 1 cut(s) 244
BbsI GAAGAC 1 cut(s) 183
Bbv12I GWGCWC 1 cut(s) 21
BccI CCATC 1 cut(s) 173
BciT130I CCWGG 1 cut(s) 201
BciVI GTATCC 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 9
BfuI GTATCC 1 cut(s) 31
BlpI GCTNAGC 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 201
BmeT110I CYCGRG 1 cut(s) 239
BmiI GGNNCC 1 cut(s) 246
BmrFI CCNGG 1 cut(s) 201
BmsI GCATC 2 cut(s) 136, 141
BpiI GAAGAC 1 cut(s) 183
Bpu1102I GCTNAGC 1 cut(s) 15
BsaJI CCNNGG 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse1I ACTGG 1 cut(s) 107
BseBI CCWGG 1 cut(s) 201
BseDI CCNNGG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 224
BseMII CTCAG 1 cut(s) 6
BseNI ACTGG 1 cut(s) 107
BseSI GKGCMC 1 cut(s) 247
BshNI GGYRCC 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 21
BsiHKCI CYCGRG 1 cut(s) 239
BslFI GGGAC 1 cut(s) 156
BslI CCNNNNNNNGG 1 cut(s) 224
BsmAI GTCTC 1 cut(s) 9
BsmFI GGGAC 1 cut(s) 156
BsmI GAATGC 1 cut(s) 71
BsoBI CYCGRG 1 cut(s) 239
Bsp1286I GDGCHC 2 cut(s) 21, 247
Bsp1720I GCTNAGC 1 cut(s) 15
BspCNI CTCAG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 246
BspT107I GGYRCC 1 cut(s) 244
BsrI ACTGG 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 22
Bst2UI CCWGG 1 cut(s) 201
BstDEI CTNAG 2 cut(s) 15, 72
BstMAI GTCTC 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 66
BstNI CCWGG 1 cut(s) 201
BstSCI CCNGG 1 cut(s) 199
BstSLI GKGCMC 1 cut(s) 247
BstV2I GAAGAC 1 cut(s) 183
BsuI GTATCC 1 cut(s) 31
Csp6I GTAC 1 cut(s) 157
CviJI RGCY 3 cut(s) 14, 60, 119
CviKI_1 RGCY 3 cut(s) 14, 60, 119
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 2 cut(s) 15, 72
DraI TTTAAA 1 cut(s) 46
Eco88I CYCGRG 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 199
FaiI YATR 2 cut(s) 197, 277
FalI AAGNNNNNCTT 2 cut(s) 131, 163
FaqI GGGAC 1 cut(s) 156
HinfI GANTC 2 cut(s) 106, 209
Hpy188III TCNNGA 3 cut(s) 131, 218, 260
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 69, 154
HpyF10VI GCNNNNNNNGC 1 cut(s) 66
HpyF3I CTNAG 2 cut(s) 15, 72
LpnPI CCDG 6 cut(s) 66, 88, 186, 213, 231, 273
LweI GCATC 2 cut(s) 136, 141
MboII GAAGA 2 cut(s) 183, 248
MhlI GDGCHC 2 cut(s) 21, 247
MluCI AATT 5 cut(s) 110, 162, 168, 204, 234
MnlI CCTC 2 cut(s) 28, 32
MroXI GAANNNNTTC 1 cut(s) 213
MseI TTAA 1 cut(s) 45
MslI CAYNNNNRTG 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 201
Mva1269I GAATGC 1 cut(s) 71
MvaI CCWGG 1 cut(s) 201
MwoI GCNNNNNNNGC 1 cut(s) 66
NlaIV GGNNCC 1 cut(s) 246
OliI CACNNNNGTG 1 cut(s) 24
PctI GAATGC 1 cut(s) 71
PdmI GAANNNNTTC 1 cut(s) 213
PfeI GAWTC 2 cut(s) 106, 209
Psp6I CCWGG 1 cut(s) 199
PspGI CCWGG 1 cut(s) 199
PspN4I GGNNCC 1 cut(s) 246
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 24
SaqAI TTAA 1 cut(s) 45
ScrFI CCNGG 1 cut(s) 201
SduI GDGCHC 2 cut(s) 21, 247
SetI ASST 1 cut(s) 24
SfaNI GCATC 2 cut(s) 136, 141
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 5 cut(s) 110, 162, 168, 204, 234
StyD4I CCNGG 1 cut(s) 199
TasI AATT 5 cut(s) 110, 162, 168, 204, 234
TfiI GAWTC 2 cut(s) 106, 209
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
XapI RAATTY 1 cut(s) 234
XmnI GAANNNNTTC 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.