Prupe.7G096700_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0001089
Physical Location & Seq
Forward (+)
12841140 .. 12841688
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G096700.1

Sequence Viewer

Length: 549 bp
ATGTCCTTATTGTCCCAAGTTCATCCACAAGCCCCAAATGTCCAACTAAACTCGCTCTTCATGTCCAAATTTAACATCTCCAACACAACATTGGGGGCTAATTGGGACATGACCCTTACAATAGACAACCCCAACCTGCTCACATGGGTTCGTTTCAACCACATCAAGGGTTCAATGTCGTACAAAGATAACATCCTCGCGATAAGCTCCATCGAGCCATTCATGTTGGGATTGAAGGAACGAAGAACGGTGAGGGTGAAGATATCGACGATGGGGTTGGGGGAAGAGGATCGTGATCATCAGCTGGTGGTGAAGAAGAGGGTTTTGGATGAGATGATGAGCAAGAGACGTGAGGATGGAGCTGTGCATTTTAGCATGCAAATGTTTGTTTGGGCCACGTATAGGACTGGTTTGTGGGGGACACAACAAGATGTTGTGATGAGCCCTCAGTGTTTGGATTTGAAGGTTGGGTTCTCGCGTGGAATTGGGTTCGGGAGTGGGATTAGTGGAGGGCCTATGATGTGTTCTGTTCCTATATTAATTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

183

Amino Acids

20.47

Weight (kDa)

9.26

Isoelectric Point (pI)

48.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 144
AccII CGCG 2 cut(s) 200, 478
AclWI GGATC 1 cut(s) 297
AcsI RAATTY 1 cut(s) 68
AfaI GTAC 1 cut(s) 182
AfiI CCNNNNNNNGG 2 cut(s) 166, 402
AgsI TTSAA 4 cut(s) 157, 174, 235, 463
AjiI CACGTC 1 cut(s) 350
AjuI GAANNNNNNNTTGG 2 cut(s) 308, 340
AluBI AGCT 3 cut(s) 207, 304, 362
AluI AGCT 3 cut(s) 207, 304, 362
Alw26I GTCTC 1 cut(s) 340
AlwI GGATC 1 cut(s) 297
AoxI GGCC 2 cut(s) 393, 512
ApoI RAATTY 1 cut(s) 68
AseI ATTAAT 2 cut(s) 539, 543
AspS9I GGNCC 2 cut(s) 393, 512
AsuHPI GGTGA 3 cut(s) 262, 268, 322
BanII GRGCYC 1 cut(s) 446
BccI CCATC 3 cut(s) 218, 265, 350
BclI TGATCA 1 cut(s) 295
BcoDI GTCTC 1 cut(s) 340
BfuAI ACCTGC 1 cut(s) 144
BmgBI CACGTC 1 cut(s) 350
BmgT120I GGNCC 2 cut(s) 393, 512
BsaAI YACGTR 1 cut(s) 399
BsaBI GATNNNNATC 1 cut(s) 294
Bsc4I CCNNNNNNNGG 2 cut(s) 166, 402
Bse1I ACTGG 1 cut(s) 412
Bse8I GATNNNNATC 1 cut(s) 294
BseGI GGATG 4 cut(s) 22, 192, 334, 361
BseJI GATNNNNATC 1 cut(s) 294
BseLI CCNNNNNNNGG 2 cut(s) 166, 402
BseMII CTCAG 1 cut(s) 461
BseNI ACTGG 1 cut(s) 412
Bsh1236I CGCG 2 cut(s) 200, 478
BshFI GGCC 2 cut(s) 395, 514
BslFI GGGAC 2 cut(s) 119, 433
BslI CCNNNNNNNGG 2 cut(s) 166, 402
BsmAI GTCTC 1 cut(s) 340
BsmBI CGTCTC 1 cut(s) 340
BsmFI GGGAC 2 cut(s) 119, 433
BsnI GGCC 2 cut(s) 395, 514
Bsp1286I GDGCHC 1 cut(s) 446
Bsp143I GATC 2 cut(s) 289, 295
Bsp68I TCGCGA 1 cut(s) 200
BspANI GGCC 2 cut(s) 395, 514
BspCNI CTCAG 1 cut(s) 460
BspFNI CGCG 2 cut(s) 200, 478
BspMI ACCTGC 1 cut(s) 144
BspPI GGATC 1 cut(s) 297
BspQI GCTCTTC 1 cut(s) 62
BsrI ACTGG 1 cut(s) 412
BssMI GATC 2 cut(s) 289, 295
Bst4CI ACNGT 1 cut(s) 250
Bst6I CTCTTC 3 cut(s) 62, 279, 311
BstBAI YACGTR 1 cut(s) 399
BstC8I GCNNGC 1 cut(s) 377
BstDEI CTNAG 1 cut(s) 447
BstF5I GGATG 4 cut(s) 22, 192, 334, 361
BstFNI CGCG 2 cut(s) 200, 478
BstKTI GATC 2 cut(s) 292, 298
BstMAI GTCTC 1 cut(s) 340
BstMBI GATC 2 cut(s) 289, 295
BstNSI RCATGY 1 cut(s) 379
BstUI CGCG 2 cut(s) 200, 478
BsuRI GGCC 2 cut(s) 395, 514
BtrI CACGTC 1 cut(s) 350
BtsCI GGATG 4 cut(s) 22, 192, 334, 361
BtsIMutI CAGTG 1 cut(s) 455
BtuMI TCGCGA 1 cut(s) 200
BveI ACCTGC 1 cut(s) 144
Cac8I GCNNGC 1 cut(s) 377
Cfr13I GGNCC 2 cut(s) 393, 512
Csp6I GTAC 1 cut(s) 181
CviAII CATG 5 cut(s) 61, 109, 144, 223, 376
CviJI RGCY 9 cut(s) 32, 98, 207, 217, 304, 362, 395, 444, 514
CviKI_1 RGCY 9 cut(s) 32, 98, 207, 217, 304, 362, 395, 444, 514
CviQI GTAC 1 cut(s) 181
DdeI CTNAG 1 cut(s) 447
DpnI GATC 2 cut(s) 291, 297
DpnII GATC 2 cut(s) 289, 295
Eam1104I CTCTTC 3 cut(s) 62, 279, 311
EarI CTCTTC 3 cut(s) 62, 279, 311
Eco24I GRGCYC 1 cut(s) 446
Eco32I GATATC 1 cut(s) 264
EcoO109I RGGNCCY 1 cut(s) 512
EcoRV GATATC 1 cut(s) 264
EcoT38I GRGCYC 1 cut(s) 446
Esp3I CGTCTC 1 cut(s) 340
FaeI CATG 5 cut(s) 64, 112, 147, 226, 379
FaiI YATR 8 cut(s) 62, 110, 145, 224, 377, 402, 518, 536
FaqI GGGAC 2 cut(s) 119, 433
FatI CATG 5 cut(s) 60, 108, 143, 222, 375
FbaI TGATCA 1 cut(s) 295
FokI GGATG 4 cut(s) 9, 179, 341, 368
FriOI GRGCYC 1 cut(s) 446
HaeIII GGCC 2 cut(s) 395, 514
Hin1II CATG 5 cut(s) 64, 112, 147, 226, 379
HphI GGTGA 3 cut(s) 262, 268, 322
Hpy188III TCNNGA 3 cut(s) 199, 293, 493
Hpy99I CGWCG 1 cut(s) 271
HpyAV CCTTC 2 cut(s) 229, 457
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4IV ACGT 2 cut(s) 349, 398
HpyCH4V TGCA 2 cut(s) 367, 379
HpyF3I CTNAG 1 cut(s) 447
HpySE526I ACGT 2 cut(s) 349, 398
Hsp92II CATG 5 cut(s) 64, 112, 147, 226, 379
Ksp22I TGATCA 1 cut(s) 295
Kzo9I GATC 2 cut(s) 289, 295
LguI GCTCTTC 1 cut(s) 62
LmnI GCTCC 2 cut(s) 212, 359
LpnPI CCDG 3 cut(s) 149, 290, 393
MaeII ACGT 2 cut(s) 349, 398
MalI GATC 2 cut(s) 291, 297
MboI GATC 2 cut(s) 289, 295
MboII GAAGA 6 cut(s) 49, 255, 271, 296, 325, 328
MhlI GDGCHC 1 cut(s) 446
MluCI AATT 5 cut(s) 68, 100, 483, 540, 544
MmeI TCCRAC 2 cut(s) 67, 105
MnlI CCTC 7 cut(s) 206, 246, 280, 312, 346, 456, 503
MseI TTAA 3 cut(s) 72, 539, 543
MslI CAYNNNNRTG 1 cut(s) 380
MspA1I CMGCKG 1 cut(s) 304
MvnI CGCG 2 cut(s) 200, 478
NdeII GATC 2 cut(s) 289, 295
NlaIII CATG 5 cut(s) 64, 112, 147, 226, 379
NruI TCGCGA 1 cut(s) 200
NspI RCATGY 1 cut(s) 379
PacI TTAATTAA 1 cut(s) 543
PaeI GCATGC 1 cut(s) 379
PciSI GCTCTTC 1 cut(s) 62
Ppu21I YACGTR 1 cut(s) 399
PshBI ATTAAT 2 cut(s) 539, 543
PspPI GGNCC 2 cut(s) 393, 512
PvuII CAGCTG 1 cut(s) 304
RruI TCGCGA 1 cut(s) 200
RsaI GTAC 1 cut(s) 182
RsaNI GTAC 1 cut(s) 181
RseI CAYNNNNRTG 1 cut(s) 380
SapI GCTCTTC 1 cut(s) 62
SaqAI TTAA 3 cut(s) 72, 539, 543
Sau3AI GATC 2 cut(s) 289, 295
Sau96I GGNCC 2 cut(s) 393, 512
SduI GDGCHC 1 cut(s) 446
SetI ASST 7 cut(s) 138, 209, 306, 352, 364, 401, 468
SmiMI CAYNNNNRTG 1 cut(s) 380
SphI GCATGC 1 cut(s) 379
Sse9I AATT 5 cut(s) 68, 100, 483, 540, 544
TaaI ACNGT 1 cut(s) 250
TaiI ACGT 2 cut(s) 352, 401
TaqI TCGA 2 cut(s) 213, 266
TasI AATT 5 cut(s) 68, 100, 483, 540, 544
Tru1I TTAA 3 cut(s) 72, 539, 543
Tru9I TTAA 3 cut(s) 72, 539, 543
TscAI CASTG 1 cut(s) 455
TspDTI ATGAA 3 cut(s) 11, 49, 211
TspRI CASTG 1 cut(s) 455
VspI ATTAAT 2 cut(s) 539, 543
XapI RAATTY 1 cut(s) 68
XceI RCATGY 1 cut(s) 379
XcmI CCANNNNNNNNNTGG 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.