Rorug02G0251900

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
26219295 .. 26219468
174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0251900.1

Sequence Viewer

Length: 174 bp
ATGGCGCTGCAAATGAAGGCTCTATTTGGTGGAGGTTGGTTCCAGGTTTCATTTCAAGGTTATATGGTAGCGACCGCTCCTCTATTGTTCAATACAGGTTTAGATAGCAATTCAGTTTATGGGTCTTGGGTTCTTATGTGTTATTCCGCATTGCTTAATTTTATGTATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.39

Weight (kDa)

5.58

Isoelectric Point (pI)

30.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 77
AciI CCGC 2 cut(s) 75, 147
AgsI TTSAA 2 cut(s) 56, 91
AjnI CCWGG 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 7
AspLEI GCGC 1 cut(s) 7
BciT130I CCWGG 1 cut(s) 44
BfoI RGCGCY 1 cut(s) 8
BisI GCNGC 1 cut(s) 8
BlsI GCNGC 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 44
Bse3DI GCAATG 1 cut(s) 149
BseBI CCWGG 1 cut(s) 44
BseMI GCAATG 1 cut(s) 149
BseRI GAGGAG 1 cut(s) 69
Bsh1285I CGRYCG 1 cut(s) 75
BsiEI CGRYCG 1 cut(s) 75
BspACI CCGC 2 cut(s) 75, 147
BspLI GGNNCC 1 cut(s) 41
BsrBI CCGCTC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 44
BstH2I RGCGCY 1 cut(s) 8
BstHHI GCGC 1 cut(s) 7
BstMCI CGRYCG 1 cut(s) 75
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
CfoI GCGC 1 cut(s) 7
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
EcoRII CCWGG 1 cut(s) 42
FaiI YATR 5 cut(s) 63, 65, 120, 137, 164
Fnu4HI GCNGC 1 cut(s) 8
Fsp4HI GCNGC 1 cut(s) 8
GlaI GCGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 8
HaeII RGCGCY 1 cut(s) 8
HhaI GCGC 1 cut(s) 7
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HpyAV CCTTC 1 cut(s) 10
HpyCH4V TGCA 1 cut(s) 10
HspAI GCGC 1 cut(s) 5
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 3 cut(s) 29, 56, 81
MbiI CCGCTC 1 cut(s) 77
MluCI AATT 2 cut(s) 109, 157
MnlI CCTC 2 cut(s) 26, 90
MseI TTAA 1 cut(s) 156
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
NlaIV GGNNCC 1 cut(s) 41
PkrI GCNGC 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 41
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 1 cut(s) 8
ScrFI CCNGG 1 cut(s) 44
SetI ASST 4 cut(s) 37, 48, 61, 100
SgeI CNNG 5 cut(s) 55, 56, 68, 108, 138
Sse9I AATT 2 cut(s) 109, 157
SsiI CCGC 2 cut(s) 75, 147
StyD4I CCNGG 1 cut(s) 42
TasI AATT 2 cut(s) 109, 157
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseI GCWGC 1 cut(s) 7
TspDTI ATGAA 2 cut(s) 29, 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.