pycom12g07720

UPF0481 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0001605
Physical Location & Seq
Reverse (-)
8325456 .. 8326169
714 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g07720.1

Sequence Viewer

Length: 714 bp
ATGTTGCTGATCGACAAACAGGACTTGCTTTTGCTAGAGAATCAACTCCCCTATCTACTCCTCAAGTTGCTGATCGACAAGAGAAAAACACGTGAGCAATGGAGTACCACAATCGAGGCTTTTGTCAAGATGTATGGTGGGGAACCACTAGTTAAGGGCCATGCCAAGGAAAAAGATCCAATTCATCTTCTTGGCCTTCTTCGGACAAAAATGGTAGGACATCCACCTAGCTCGAGTACAAAAGTAGGAGGTACTCAACTTCTTGACCTTTTTTTGACAAGAATGGTAGCATCTCCACCTAGCCGAAGTAGTATGCACCATTCACTTCGCAATGTACAACAACTTCATGAAGCCGAGATCCATTTTAGGCTTAGTGAGAAAAACTCAATGAGGGACGTAAATTTTAAGCCTTGGTTTCTATGTTGTGGATTCCTTTATCTTCTTATAATAATAGTTGACGACTCGATGGGGCCTAAGTTCATAAACATGATAGCCTACAATATGTGTCCTGATTTCCAAAAAAACTTCAAGGTTACCTCTTACATAGGCTTGCTCGATTTGCTCATTGGTCATCCAGACGATGTGAAGCACTTAAGGAAAAGGGGCATACTTCAAAACTTTGTTAGGAGTGATGAAGAGGTGGCTCAACTCTTTAATGAGATAACCATTGACTTGGTCCCTAAAGATGCGATTTTCTCCAATGTTAAAGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

238

Amino Acids

27.2

Weight (kDa)

8.89

Isoelectric Point (pI)

38.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 6 - 226 2.2e-42 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 446
AclWI GGATC 2 cut(s) 170, 352
AcsI RAATTY 1 cut(s) 400
AcvI CACGTG 1 cut(s) 92
AfaI GTAC 4 cut(s) 106, 238, 253, 336
AfiI CCNNNNNNNGG 1 cut(s) 166
AflII CTTAAG 1 cut(s) 592
AflIII ACRYGT 1 cut(s) 89
AgsI TTSAA 2 cut(s) 529, 614
AhlI ACTAGT 1 cut(s) 148
AluBI AGCT 1 cut(s) 231
AluI AGCT 1 cut(s) 231
AlwI GGATC 2 cut(s) 170, 352
Ama87I CYCGRG 1 cut(s) 232
AoxI GGCC 3 cut(s) 157, 193, 470
ApoI RAATTY 1 cut(s) 400
AspS9I GGNCC 3 cut(s) 157, 470, 676
AvaI CYCGRG 1 cut(s) 232
AvaII GGWCC 1 cut(s) 676
BarI GAAGNNNNNNTAC 2 cut(s) 327, 359
BbrPI CACGTG 1 cut(s) 92
BccI CCATC 1 cut(s) 460
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 4 cut(s) 35, 149, 228, 300
BfrI CTTAAG 1 cut(s) 592
Bme18I GGWCC 1 cut(s) 676
BmeT110I CYCGRG 1 cut(s) 232
BmgT120I GGNCC 3 cut(s) 157, 470, 676
BmiI GGNNCC 3 cut(s) 144, 471, 678
BmsI GCATC 2 cut(s) 299, 676
BplI GAGNNNNNCTC 2 cut(s) 368, 400
BpuEI CTTGAG 1 cut(s) 47
BsaAI YACGTR 1 cut(s) 92
BsaJI CCNNGG 2 cut(s) 165, 410
Bsc4I CCNNNNNNNGG 1 cut(s) 166
Bse3DI GCAATG 2 cut(s) 104, 337
BseDI CCNNGG 2 cut(s) 165, 410
BseGI GGATG 2 cut(s) 220, 571
BseLI CCNNNNNNNGG 1 cut(s) 166
BseMI GCAATG 2 cut(s) 104, 337
BseRI GAGGAG 1 cut(s) 50
BshFI GGCC 3 cut(s) 159, 195, 472
BsiHKCI CYCGRG 1 cut(s) 232
BslFI GGGAC 2 cut(s) 407, 662
BslI CCNNNNNNNGG 1 cut(s) 166
BsmFI GGGAC 2 cut(s) 407, 662
BsnI GGCC 3 cut(s) 159, 195, 472
BsoBI CYCGRG 1 cut(s) 232
Bsp1407I TGTACA 1 cut(s) 334
Bsp143I GATC 4 cut(s) 9, 72, 175, 357
BspANI GGCC 3 cut(s) 159, 195, 472
BspHI TCATGA 1 cut(s) 346
BspLI GGNNCC 3 cut(s) 144, 471, 678
BspPI GGATC 2 cut(s) 170, 352
BspTI CTTAAG 1 cut(s) 592
BsrDI GCAATG 2 cut(s) 104, 337
BsrGI TGTACA 1 cut(s) 334
BssECI CCNNGG 2 cut(s) 165, 410
BssMI GATC 4 cut(s) 9, 72, 175, 357
BssT1I CCWWGG 2 cut(s) 165, 410
Bst6I CTCTTC 1 cut(s) 630
BstAFI CTTAAG 1 cut(s) 592
BstAUI TGTACA 1 cut(s) 334
BstBAI YACGTR 1 cut(s) 92
BstC8I GCNNGC 1 cut(s) 551
BstDEI CTNAG 2 cut(s) 371, 474
BstEII GGTNACC 1 cut(s) 532
BstF5I GGATG 2 cut(s) 220, 571
BstKTI GATC 4 cut(s) 12, 75, 178, 360
BstMBI GATC 4 cut(s) 9, 72, 175, 357
BstMWI GCNNNNNNNGC 1 cut(s) 559
BstPI GGTNACC 1 cut(s) 532
BstX2I RGATCY 2 cut(s) 175, 357
BstXI CCANNNNNNTGG 1 cut(s) 673
BstYI RGATCY 2 cut(s) 175, 357
BsuRI GGCC 3 cut(s) 159, 195, 472
BtsCI GGATG 2 cut(s) 220, 571
Cac8I GCNNGC 1 cut(s) 551
CciI TCATGA 1 cut(s) 346
Cfr13I GGNCC 3 cut(s) 157, 470, 676
Csp6I GTAC 4 cut(s) 105, 237, 252, 335
CviAII CATG 3 cut(s) 161, 347, 487
CviQI GTAC 4 cut(s) 105, 237, 252, 335
DdeI CTNAG 2 cut(s) 371, 474
DpnI GATC 4 cut(s) 11, 74, 177, 359
DpnII GATC 4 cut(s) 9, 72, 175, 357
Eam1104I CTCTTC 1 cut(s) 630
EarI CTCTTC 1 cut(s) 630
Eco130I CCWWGG 2 cut(s) 165, 410
Eco47I GGWCC 1 cut(s) 676
Eco72I CACGTG 1 cut(s) 92
Eco88I CYCGRG 1 cut(s) 232
Eco91I GGTNACC 1 cut(s) 532
EcoO109I RGGNCCY 1 cut(s) 470
EcoO65I GGTNACC 1 cut(s) 532
EcoT14I CCWWGG 2 cut(s) 165, 410
ErhI CCWWGG 2 cut(s) 165, 410
FaeI CATG 3 cut(s) 164, 350, 490
FaqI GGGAC 2 cut(s) 407, 662
FatI CATG 3 cut(s) 160, 346, 486
FokI GGATG 2 cut(s) 207, 558
FspBI CTAG 4 cut(s) 35, 149, 228, 300
HaeIII GGCC 3 cut(s) 159, 195, 472
Hin1II CATG 3 cut(s) 164, 350, 490
HincII GTYRAC 1 cut(s) 457
HindII GTYRAC 1 cut(s) 457
HinfI GANTC 3 cut(s) 40, 429, 461
Hpy166II GTNNAC 1 cut(s) 457
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 5 cut(s) 127, 263, 347, 509, 575
Hpy8I GTNNAC 1 cut(s) 457
HpyAV CCTTC 1 cut(s) 206
HpyCH4IV ACGT 2 cut(s) 91, 396
HpyCH4V TGCA 1 cut(s) 316
HpyF10VI GCNNNNNNNGC 1 cut(s) 559
HpyF3I CTNAG 2 cut(s) 371, 474
HpySE526I ACGT 2 cut(s) 91, 396
Hsp92II CATG 3 cut(s) 164, 350, 490
Kzo9I GATC 4 cut(s) 9, 72, 175, 357
LpnPI CCDG 3 cut(s) 5, 522, 588
LweI GCATC 2 cut(s) 299, 676
MaeI CTAG 4 cut(s) 35, 149, 228, 300
MaeII ACGT 2 cut(s) 91, 396
MaeIII GTNAC 1 cut(s) 532
MalI GATC 4 cut(s) 11, 74, 177, 359
MboI GATC 4 cut(s) 9, 72, 175, 357
MboII GAAGA 4 cut(s) 179, 191, 431, 647
MflI RGATCY 2 cut(s) 175, 357
MluCI AATT 2 cut(s) 180, 400
MlyI GAGTC 1 cut(s) 455
MnlI CCTC 6 cut(s) 71, 109, 242, 384, 547, 631
MseI TTAA 5 cut(s) 153, 405, 593, 654, 705
MslI CAYNNNNRTG 1 cut(s) 485
MspCI CTTAAG 1 cut(s) 592
MwoI GCNNNNNNNGC 1 cut(s) 559
NdeII GATC 4 cut(s) 9, 72, 175, 357
NlaIII CATG 3 cut(s) 164, 350, 490
NlaIV GGNNCC 3 cut(s) 144, 471, 678
NmeAIII GCCGAG 1 cut(s) 379
PaeR7I CTCGAG 1 cut(s) 232
PagI TCATGA 1 cut(s) 346
PfeI GAWTC 2 cut(s) 40, 429
PflFI GACNNNGTC 1 cut(s) 674
PleI GAGTC 1 cut(s) 455
PmaCI CACGTG 1 cut(s) 92
PmlI CACGTG 1 cut(s) 92
PpsI GAGTC 1 cut(s) 455
Ppu21I YACGTR 1 cut(s) 92
PsiI TTATAA 1 cut(s) 446
PspCI CACGTG 1 cut(s) 92
PspEI GGTNACC 1 cut(s) 532
PspN4I GGNNCC 3 cut(s) 144, 471, 678
PspPI GGNCC 3 cut(s) 157, 470, 676
PspXI VCTCGAGB 1 cut(s) 232
PsuI RGATCY 2 cut(s) 175, 357
PsyI GACNNNGTC 1 cut(s) 674
RsaI GTAC 4 cut(s) 106, 238, 253, 336
RsaNI GTAC 4 cut(s) 105, 237, 252, 335
RseI CAYNNNNRTG 1 cut(s) 485
SaqAI TTAA 5 cut(s) 153, 405, 593, 654, 705
Sau3AI GATC 4 cut(s) 9, 72, 175, 357
Sau96I GGNCC 3 cut(s) 157, 470, 676
SchI GAGTC 1 cut(s) 455
SfaNI GCATC 2 cut(s) 299, 676
Sfr274I CTCGAG 1 cut(s) 232
SinI GGWCC 1 cut(s) 676
SlaI CTCGAG 1 cut(s) 232
SmiMI CAYNNNNRTG 1 cut(s) 485
SmlI CTYRAG 3 cut(s) 62, 232, 592
SmoI CTYRAG 3 cut(s) 62, 232, 592
SpeI ACTAGT 1 cut(s) 148
Sse9I AATT 2 cut(s) 180, 400
SspMI CTAG 4 cut(s) 35, 149, 228, 300
StyI CCWWGG 2 cut(s) 165, 410
TaiI ACGT 2 cut(s) 94, 399
TaqI TCGA 6 cut(s) 12, 75, 114, 233, 464, 555
TasI AATT 2 cut(s) 180, 400
TatI WGTACW 2 cut(s) 236, 334
TfiI GAWTC 2 cut(s) 40, 429
Tru1I TTAA 5 cut(s) 153, 405, 593, 654, 705
Tru9I TTAA 5 cut(s) 153, 405, 593, 654, 705
TspDTI ATGAA 5 cut(s) 173, 335, 363, 469, 648
Tth111I GACNNNGTC 1 cut(s) 674
Vha464I CTTAAG 1 cut(s) 592
VpaK11BI GGWCC 1 cut(s) 676
XapI RAATTY 1 cut(s) 400
XhoI CTCGAG 1 cut(s) 232
XspI CTAG 4 cut(s) 35, 149, 228, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.