RchiOBHm_Chr3g0484961

Agenet domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
31540915 .. 31541127
213 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGTGGGTGATAGGATCGATGCTTACAATCTTAATGGGTGGTGGGTCGATACGATTTTGTAGGAGGAAAATGGGTCTGGGGCATCAGTCCGTGTTTTTTGAGACTACTGGGCAAGAGCTTGATTACCCAGTTTTGAAGTTGAGGGTTCATCAAGATTGGCGCAATGGGAAATGGGTGTCGTCCAAGAAGACCAAGAGGAATGCTGTGCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.12

Weight (kDa)

11.0

Isoelectric Point (pI)

49.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000631)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G06340
fragaria_vesca FvH4_2g23230 FvH4_6g05270 FvH4_6g14470
malus_domestica MD04G1194400.v1.1 MD04G1194500.v1.1 MD04G1194700.v1.1 MD04G1194900.v1.1 MD04G1199300.v1.1 MD12G1207100.v1.1
prunus_persica Prupe.6G295700_v2.0.a1 Prupe.6G314400_v2.0.a1 Prupe.6G314500_v2.0.a1
pyrus_communis pycom04g17200 pycom12g19490
rosa_chinensis RchiOBHm_Chr1g0336721 RchiOBHm_Chr3g0454011 RchiOBHm_Chr3g0484961 RchiOBHm_Chr6g0290501 RchiOBHm_Chr6g0290521 RchiOBHm_Chr6g0290541 RchiOBHm_Chr7g0235761
rosa_laevigata RLG00000001142 RLG00000006528 RLG00000012205 RLG00000012207 RLG00000012209 RLG00000024490 RLG00000025490 RLG00000035862
rosa_multiflora Rmu_co8053086.1_g000001 Rmu_sc0000679.1_g000031 Rmu_sc0001089.1_g000020 Rmu_sc0001302.1_g000001 Rmu_sc0002477.1_g000009 Rmu_sc0002724.1_g000039 Rmu_sc0002890.1_g000020 Rmu_sc0002890.1_g000022 Rmu_sc0003556.1_g000036 Rmu_sc0009295.1_g000012 Rmu_sc0011632.1_g000017 Rmu_sc0019265.1_g000002
rosa_roxburghii Rroxscaffold_4G00326260 Rroxscaffold_6G00413590 Rroxscaffold_7G00176960 Rroxscaffold_7G00176980 Rroxscaffold_7G00177000
rosa_rugosa Rorug06G0212900
rosa_samantha Rh1AG103800 Rh1BG086300 Rh2AG280500 Rh2AG280600 Rh3AG054900 Rh3AG136100 Rh3BG056500 Rh3BG158000 Rh3CG055700 Rh3CG157800 Rh3DG057000 Rh3DG158600 Rh6AG323500 Rh6AG323700 Rh6BG330700 Rh6BG330900 Rh6BG331100 Rh6BG413200 Rh6CG337000 Rh6CG337100 Rh6CG337300 Rh6DG323900 Rh6DG324100 Rh6DG324300 Rh7DG436300
rosa_wichuraiana Rw3G004220 Rw3G012920 Rw6G028060 Rw6G028080 Rw7G037160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 22
AgsI TTSAA 1 cut(s) 136
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
Alw26I GTCTC 1 cut(s) 95
AlwI GGATC 1 cut(s) 22
AspLEI GCGC 1 cut(s) 162
AsuHPI GGTGA 1 cut(s) 19
BbsI GAAGAC 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 95
BmrI ACTGGG 2 cut(s) 117, 122
BmsI GCATC 2 cut(s) 9, 91
BmuI ACTGGG 2 cut(s) 117, 122
BpiI GAAGAC 1 cut(s) 194
Bsa29I ATCGAT 1 cut(s) 17
Bse1I ACTGG 2 cut(s) 112, 128
Bse3DI GCAATG 1 cut(s) 169
BseCI ATCGAT 1 cut(s) 17
BseMI GCAATG 1 cut(s) 169
BseNI ACTGG 2 cut(s) 112, 128
BshVI ATCGAT 1 cut(s) 17
BsmAI GTCTC 1 cut(s) 95
BsmI GAATGC 1 cut(s) 205
Bsp143I GATC 1 cut(s) 14
BspDI ATCGAT 1 cut(s) 17
BspPI GGATC 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 169
BsrI ACTGG 2 cut(s) 112, 128
BssMI GATC 1 cut(s) 14
BstHHI GCGC 1 cut(s) 162
BstKTI GATC 1 cut(s) 17
BstMAI GTCTC 1 cut(s) 95
BstMBI GATC 1 cut(s) 14
BstV2I GAAGAC 1 cut(s) 194
Bsu15I ATCGAT 1 cut(s) 17
BsuTUI ATCGAT 1 cut(s) 17
CfoI GCGC 1 cut(s) 162
ClaI ATCGAT 1 cut(s) 17
CviJI RGCY 1 cut(s) 118
CviKI_1 RGCY 1 cut(s) 118
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
GlaI GCGC 1 cut(s) 161
HhaI GCGC 1 cut(s) 162
Hin6I GCGC 1 cut(s) 160
HinP1I GCGC 1 cut(s) 160
HphI GGTGA 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 152
HspAI GCGC 1 cut(s) 160
Kzo9I GATC 1 cut(s) 14
LpnPI CCDG 3 cut(s) 62, 93, 141
LweI GCATC 2 cut(s) 9, 91
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 1 cut(s) 199
MnlI CCTC 3 cut(s) 57, 135, 189
MseI TTAA 1 cut(s) 32
Mva1269I GAATGC 1 cut(s) 205
NdeII GATC 1 cut(s) 14
PctI GAATGC 1 cut(s) 205
SaqAI TTAA 1 cut(s) 32
Sau3AI GATC 1 cut(s) 14
SetI ASST 1 cut(s) 120
SfaNI GCATC 2 cut(s) 9, 91
SgeI CNNG 9 cut(s) 89, 103, 120, 125, 131, 140, 164, 196, 205
TaqI TCGA 2 cut(s) 17, 47
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TspDTI ATGAA 1 cut(s) 137
TspGWI ACGGA 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.