RchiOBHm_Chr1g0336721

Agenet domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0000631
Physical Location & Seq
Forward (+)
28437110 .. 28437376
267 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56466

Sequence Viewer

Length: 267 bp
ATGGAGGCTAATGTTGTGTTTCATGTGGGTGATAGGATCGATGCTTACGATCTTGATGGGTGGTGGGTCGATAAGATTTTGTCGAAGGAAAATGGGTCTGGGCATCAGTCCGTGTTTTTCGAGACTACTGGGCAAGAGCTTGATTACCCAGTTTTGAAGCTGAGGGTTCATCAAGATTGGCGCAATGGGAAATGGGTGTCGTCCAAGAAGACCAAGAGGAATGATGTGTTGTTTTGGGCTTCTGATTGTTCTGATCTTGTTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Agenet

Protein Analysis

88

Amino Acids

10.2

Weight (kDa)

5.47

Isoelectric Point (pI)

23.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000631)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G06340
fragaria_vesca FvH4_2g23230 FvH4_6g05270 FvH4_6g14470
malus_domestica MD04G1194400.v1.1 MD04G1194500.v1.1 MD04G1194700.v1.1 MD04G1194900.v1.1 MD04G1199300.v1.1 MD12G1207100.v1.1
prunus_persica Prupe.6G295700_v2.0.a1 Prupe.6G314400_v2.0.a1 Prupe.6G314500_v2.0.a1
pyrus_communis pycom04g17200 pycom12g19490
rosa_chinensis RchiOBHm_Chr1g0336721 RchiOBHm_Chr3g0454011 RchiOBHm_Chr3g0484961 RchiOBHm_Chr6g0290501 RchiOBHm_Chr6g0290521 RchiOBHm_Chr6g0290541 RchiOBHm_Chr7g0235761
rosa_laevigata RLG00000001142 RLG00000006528 RLG00000012205 RLG00000012207 RLG00000012209 RLG00000024490 RLG00000025490 RLG00000035862
rosa_multiflora Rmu_co8053086.1_g000001 Rmu_sc0000679.1_g000031 Rmu_sc0001089.1_g000020 Rmu_sc0001302.1_g000001 Rmu_sc0002477.1_g000009 Rmu_sc0002724.1_g000039 Rmu_sc0002890.1_g000020 Rmu_sc0002890.1_g000022 Rmu_sc0003556.1_g000036 Rmu_sc0009295.1_g000012 Rmu_sc0011632.1_g000017 Rmu_sc0019265.1_g000002
rosa_roxburghii Rroxscaffold_4G00326260 Rroxscaffold_6G00413590 Rroxscaffold_7G00176960 Rroxscaffold_7G00176980 Rroxscaffold_7G00177000
rosa_rugosa Rorug06G0212900
rosa_samantha Rh1AG103800 Rh1BG086300 Rh2AG280500 Rh2AG280600 Rh3AG054900 Rh3AG136100 Rh3BG056500 Rh3BG158000 Rh3CG055700 Rh3CG157800 Rh3DG057000 Rh3DG158600 Rh6AG323500 Rh6AG323700 Rh6BG330700 Rh6BG330900 Rh6BG331100 Rh6BG413200 Rh6CG337000 Rh6CG337100 Rh6CG337300 Rh6DG323900 Rh6DG324100 Rh6DG324300 Rh7DG436300
rosa_wichuraiana Rw3G004220 Rw3G012920 Rw6G028060 Rw6G028080 Rw7G037160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 44
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 3 cut(s) 139, 160, 264
AluI AGCT 3 cut(s) 139, 160, 264
Alw26I GTCTC 1 cut(s) 116
AlwI GGATC 1 cut(s) 44
AspLEI GCGC 1 cut(s) 183
AsuHPI GGTGA 1 cut(s) 41
BbsI GAAGAC 1 cut(s) 215
BbvCI CCTCAGC 1 cut(s) 161
BccI CCATC 1 cut(s) 50
BcoDI GTCTC 1 cut(s) 116
BfaI CTAG 1 cut(s) 265
BmrI ACTGGG 2 cut(s) 138, 143
BmsI GCATC 2 cut(s) 31, 112
BmuI ACTGGG 2 cut(s) 138, 143
BpiI GAAGAC 1 cut(s) 215
Bpu10I CCTNAGC 1 cut(s) 161
Bsa29I ATCGAT 1 cut(s) 39
Bse1I ACTGG 2 cut(s) 133, 149
Bse3DI GCAATG 1 cut(s) 190
BseCI ATCGAT 1 cut(s) 39
BseMI GCAATG 1 cut(s) 190
BseMII CTCAG 1 cut(s) 152
BseNI ACTGG 2 cut(s) 133, 149
BshVI ATCGAT 1 cut(s) 39
BsmAI GTCTC 1 cut(s) 116
Bsp143I GATC 3 cut(s) 36, 49, 253
BspCNI CTCAG 1 cut(s) 153
BspDI ATCGAT 1 cut(s) 39
BspPI GGATC 1 cut(s) 44
BsrDI GCAATG 1 cut(s) 190
BsrI ACTGG 2 cut(s) 133, 149
BssMI GATC 3 cut(s) 36, 49, 253
BstDEI CTNAG 1 cut(s) 161
BstHHI GCGC 1 cut(s) 183
BstKTI GATC 3 cut(s) 39, 52, 256
BstMAI GTCTC 1 cut(s) 116
BstMBI GATC 3 cut(s) 36, 49, 253
BstV2I GAAGAC 1 cut(s) 215
Bsu15I ATCGAT 1 cut(s) 39
BsuTUI ATCGAT 1 cut(s) 39
CfoI GCGC 1 cut(s) 183
ClaI ATCGAT 1 cut(s) 39
CviAII CATG 1 cut(s) 23
CviJI RGCY 5 cut(s) 8, 139, 160, 239, 264
CviKI_1 RGCY 5 cut(s) 8, 139, 160, 239, 264
DdeI CTNAG 1 cut(s) 161
DpnI GATC 3 cut(s) 38, 51, 255
DpnII GATC 3 cut(s) 36, 49, 253
FaeI CATG 1 cut(s) 26
FaiI YATR 1 cut(s) 24
FatI CATG 1 cut(s) 22
FspBI CTAG 1 cut(s) 265
GlaI GCGC 1 cut(s) 182
HhaI GCGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 26
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
HphI GGTGA 1 cut(s) 41
Hpy188I TCNGA 2 cut(s) 244, 253
Hpy188III TCNNGA 3 cut(s) 53, 121, 173
HpyAV CCTTC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 161
Hsp92II CATG 1 cut(s) 26
HspAI GCGC 1 cut(s) 181
Kzo9I GATC 3 cut(s) 36, 49, 253
LpnPI CCDG 3 cut(s) 84, 114, 162
LweI GCATC 2 cut(s) 31, 112
MaeI CTAG 1 cut(s) 265
MalI GATC 3 cut(s) 38, 51, 255
MboI GATC 3 cut(s) 36, 49, 253
MboII GAAGA 1 cut(s) 220
MnlI CCTC 2 cut(s) 156, 210
MslI CAYNNNNRTG 1 cut(s) 27
NdeII GATC 3 cut(s) 36, 49, 253
NlaIII CATG 1 cut(s) 26
PcsI WCGNNNNNNNCGW 1 cut(s) 45
RseI CAYNNNNRTG 1 cut(s) 27
Sau3AI GATC 3 cut(s) 36, 49, 253
SetI ASST 3 cut(s) 141, 162, 266
SfaNI GCATC 2 cut(s) 31, 112
SmiMI CAYNNNNRTG 1 cut(s) 27
SspMI CTAG 1 cut(s) 265
TaqI TCGA 4 cut(s) 39, 69, 83, 120
TspDTI ATGAA 2 cut(s) 11, 158
TspGWI ACGGA 1 cut(s) 100
XspI CTAG 1 cut(s) 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.