RchiOBHm_Chr1g0353321

Methionine adenosyltransferase 2 subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0001020
Physical Location & Seq
Forward (+)
46581709 .. 46582421
713 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57896

Sequence Viewer

Length: 234 bp
ATGAGTAGGAAGAGAGTTTTGATACTTGGAGGAACAGGTTACTTGGGACAGCATGTATTGCAAGGCTTTTCAGAGATTCAAGAAACCACTCCTTGTGATCTGGCATTTACCCACCACTCAAGTCCTCCACCCCAAGCTTTGCTCAATGCATTTCCTAGCGTGATGCCTTTCTCTGTGGATTTGAAGTCTGGCAATGGATTTGAAGCCATTTCTCATCAGTTTGGTCCGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RmlD_sub_bind

Protein Analysis

77

Amino Acids

8.28

Weight (kDa)

6.37

Isoelectric Point (pI)

60.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 80, 184, 203
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AspS9I GGNCC 1 cut(s) 224
AvaII GGWCC 1 cut(s) 224
BfaI CTAG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 1 cut(s) 224
BmsI GCATC 1 cut(s) 153
BpuEI CTTGAG 1 cut(s) 103
Bse3DI GCAATG 1 cut(s) 199
BseMI GCAATG 1 cut(s) 199
BslFI GGGAC 1 cut(s) 60
BsmFI GGGAC 1 cut(s) 60
Bsp143I GATC 1 cut(s) 97
BsrDI GCAATG 1 cut(s) 199
BssMI GATC 1 cut(s) 97
Bst6I CTCTTC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 58
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 56
Cfr13I GGNCC 1 cut(s) 224
CviAII CATG 1 cut(s) 53
CviJI RGCY 3 cut(s) 66, 137, 206
CviKI_1 RGCY 3 cut(s) 66, 137, 206
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco47I GGWCC 1 cut(s) 224
EcoT22I ATGCAT 1 cut(s) 151
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FaqI GGGAC 1 cut(s) 60
FatI CATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 156
Hin1II CATG 1 cut(s) 56
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 1 cut(s) 76
Hpy188I TCNGA 2 cut(s) 73, 228
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 61, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
Hsp92II CATG 1 cut(s) 56
Kzo9I GATC 1 cut(s) 97
LpnPI CCDG 3 cut(s) 21, 86, 174
LweI GCATC 1 cut(s) 153
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 1 cut(s) 38
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 1 cut(s) 22
MnlI CCTC 2 cut(s) 23, 135
Mph1103I ATGCAT 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 58
NdeII GATC 1 cut(s) 97
NlaIII CATG 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 151
NspI RCATGY 1 cut(s) 56
PfeI GAWTC 1 cut(s) 76
PspPI GGNCC 1 cut(s) 224
Sau3AI GATC 1 cut(s) 97
Sau96I GGNCC 1 cut(s) 224
SetI ASST 2 cut(s) 40, 139
SfaNI GCATC 1 cut(s) 153
SinI GGWCC 1 cut(s) 224
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
SspMI CTAG 1 cut(s) 156
TfiI GAWTC 1 cut(s) 76
VpaK11BI GGWCC 1 cut(s) 224
XceI RCATGY 1 cut(s) 56
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.