Rroxscaffold_4G00302020

Methionine adenosyltransferase 2 subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001020
Physical Location & Seq
Reverse (-)
22376692 .. 22380230
3539 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00302020.1

Sequence Viewer

Length: 189 bp
ATGGCTGAGACGGTTGCTGATATAAGGGCATACAATCTCTCATTAATTAAATCTGTATCCGCATCATCGGTTGATCGTGGAGTTATGTCTCCTGCTGACATATCCATGGATAGAACTAAGCTAGTTCAGATGCTTGGTATTTCTCCTATTTCATTTATAGATGGTGTCAGATTGACGCTTGAACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RmlD_sub_bind

Protein Analysis

62

Amino Acids

6.68

Weight (kDa)

4.98

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 60
AgsI TTSAA 1 cut(s) 182
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
Alw26I GTCTC 2 cut(s) 2, 93
AseI ATTAAT 1 cut(s) 44
BccI CCATC 1 cut(s) 155
BciVI GTATCC 1 cut(s) 67
BcoDI GTCTC 2 cut(s) 2, 93
BfaI CTAG 1 cut(s) 122
BfuI GTATCC 1 cut(s) 67
BmsI GCATC 2 cut(s) 71, 120
BsaJI CCNNGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 105
BsmAI GTCTC 2 cut(s) 2, 93
BsmBI CGTCTC 1 cut(s) 2
Bsp143I GATC 1 cut(s) 73
Bsp19I CCATGG 1 cut(s) 105
BspACI CCGC 1 cut(s) 60
BssECI CCNNGG 1 cut(s) 105
BssMI GATC 1 cut(s) 73
BssT1I CCWWGG 1 cut(s) 105
Bst4CI ACNGT 2 cut(s) 13, 186
BstDEI CTNAG 2 cut(s) 6, 117
BstDSI CCRYGG 1 cut(s) 105
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 2 cut(s) 2, 93
BstMBI GATC 1 cut(s) 73
BsuI GTATCC 1 cut(s) 67
BtgI CCRYGG 1 cut(s) 105
CseI GACGC 1 cut(s) 184
CviAII CATG 1 cut(s) 106
CviJI RGCY 2 cut(s) 5, 121
CviKI_1 RGCY 2 cut(s) 5, 121
DdeI CTNAG 2 cut(s) 6, 117
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco130I CCWWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 105
ErhI CCWWGG 1 cut(s) 105
Esp3I CGTCTC 1 cut(s) 2
FaeI CATG 1 cut(s) 109
FaiI YATR 6 cut(s) 23, 31, 86, 101, 107, 158
FatI CATG 1 cut(s) 105
FspBI CTAG 1 cut(s) 122
HgaI GACGC 1 cut(s) 184
Hin1II CATG 1 cut(s) 109
Hpy188I TCNGA 2 cut(s) 129, 170
HpyCH4III ACNGT 2 cut(s) 13, 186
HpyF3I CTNAG 2 cut(s) 6, 117
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 1 cut(s) 73
LpnPI CCDG 1 cut(s) 105
LweI GCATC 2 cut(s) 71, 120
MaeI CTAG 1 cut(s) 122
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MluCI AATT 1 cut(s) 45
MseI TTAA 2 cut(s) 44, 48
MslI CAYNNNNRTG 1 cut(s) 104
NcoI CCATGG 1 cut(s) 105
NdeII GATC 1 cut(s) 73
NlaIII CATG 1 cut(s) 109
PacI TTAATTAA 1 cut(s) 48
PshBI ATTAAT 1 cut(s) 44
RseI CAYNNNNRTG 1 cut(s) 104
SaqAI TTAA 2 cut(s) 44, 48
Sau3AI GATC 1 cut(s) 73
SetI ASST 1 cut(s) 123
SfaNI GCATC 2 cut(s) 71, 120
SgeI CNNG 5 cut(s) 89, 104, 118, 134, 146
SmiMI CAYNNNNRTG 1 cut(s) 104
Sse9I AATT 1 cut(s) 45
SsiI CCGC 1 cut(s) 60
SspMI CTAG 1 cut(s) 122
StyI CCWWGG 1 cut(s) 105
TaaI ACNGT 2 cut(s) 13, 186
TasI AATT 1 cut(s) 45
Tru1I TTAA 2 cut(s) 44, 48
Tru9I TTAA 2 cut(s) 44, 48
TspDTI ATGAA 1 cut(s) 141
VspI ATTAAT 1 cut(s) 44
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.