Rh1BG020800

Methionine adenosyltransferase 2 subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
2665720 .. 2666681
962 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG020800.1

Sequence Viewer

Length: 312 bp
ATGAGTAGGAAGAGAGTTTTGATAGCTGGAGGCACAGGCTATTTGGGCCAGCATGTATTGCAAGGCTTTTCAGAGATTCAAGAAACCTCTCCTTGTGATCTGGCATTTACCCACCACTCAAGTCCTCCTCCCCAAGCTTTGCTCAATGCATTTCCTAGTGTGATCATTTTCTCTGTGGATTTGAAGTCTGGCAATGGATTTGAAGCCATTTCTCATCTGTTTGGTCCGCGAGATATCCAAGTCCTAATAACAACAAATCTTGGTCGAAATTTACAAGGGATTCTAAAAGTGGGTCTTGGAGTTGAATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.09

Weight (kDa)

6.9

Isoelectric Point (pI)

43.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 229
AciI CCGC 1 cut(s) 227
AcsI RAATTY 1 cut(s) 268
AgsI TTSAA 4 cut(s) 80, 184, 203, 305
AluBI AGCT 2 cut(s) 26, 137
AluI AGCT 2 cut(s) 26, 137
AoxI GGCC 1 cut(s) 46
ApoI RAATTY 1 cut(s) 268
AspS9I GGNCC 2 cut(s) 46, 224
AvaII GGWCC 1 cut(s) 224
BclI TGATCA 1 cut(s) 162
BfaI CTAG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 224
BmgT120I GGNCC 2 cut(s) 46, 224
BpmI CTGGAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 103
Bse3DI GCAATG 1 cut(s) 199
BseMI GCAATG 1 cut(s) 199
BseRI GAGGAG 1 cut(s) 117
Bsh1236I CGCG 1 cut(s) 229
BshFI GGCC 1 cut(s) 48
BsnI GGCC 1 cut(s) 48
Bsp143I GATC 2 cut(s) 97, 162
BspACI CCGC 1 cut(s) 227
BspANI GGCC 1 cut(s) 48
BspFNI CGCG 1 cut(s) 229
BsrDI GCAATG 1 cut(s) 199
BssMI GATC 2 cut(s) 97, 162
Bst6I CTCTTC 1 cut(s) 5
BstAPI GCANNNNNTGC 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 50
BstFNI CGCG 1 cut(s) 229
BstKTI GATC 2 cut(s) 100, 165
BstMBI GATC 2 cut(s) 97, 162
BstMWI GCNNNNNNNGC 2 cut(s) 45, 58
BstNSI RCATGY 1 cut(s) 56
BstUI CGCG 1 cut(s) 229
BsuRI GGCC 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 50
Cfr13I GGNCC 2 cut(s) 46, 224
CviAII CATG 1 cut(s) 53
CviJI RGCY 6 cut(s) 26, 39, 48, 66, 137, 206
CviKI_1 RGCY 6 cut(s) 26, 39, 48, 66, 137, 206
DpnI GATC 2 cut(s) 99, 164
DpnII GATC 2 cut(s) 97, 162
Eam1104I CTCTTC 1 cut(s) 5
EarI CTCTTC 1 cut(s) 5
Eco32I GATATC 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 224
EcoRV GATATC 1 cut(s) 235
EcoT22I ATGCAT 1 cut(s) 151
FaeI CATG 1 cut(s) 56
FaiI YATR 1 cut(s) 54
FalI AAGNNNNNCTT 2 cut(s) 279, 311
FatI CATG 1 cut(s) 52
FbaI TGATCA 1 cut(s) 162
FspBI CTAG 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 48
Hin1II CATG 1 cut(s) 56
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 2 cut(s) 76, 280
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 61, 149
HpyF10VI GCNNNNNNNGC 2 cut(s) 45, 58
Hsp92II CATG 1 cut(s) 56
Ksp22I TGATCA 1 cut(s) 162
Kzo9I GATC 2 cut(s) 97, 162
LpnPI CCDG 5 cut(s) 12, 21, 62, 86, 174
MaeI CTAG 1 cut(s) 156
MalI GATC 2 cut(s) 99, 164
MboI GATC 2 cut(s) 97, 162
MboII GAAGA 1 cut(s) 22
MluCI AATT 1 cut(s) 268
MnlI CCTC 4 cut(s) 23, 97, 135, 138
Mph1103I ATGCAT 1 cut(s) 151
MvnI CGCG 1 cut(s) 229
MwoI GCNNNNNNNGC 2 cut(s) 45, 58
NdeII GATC 2 cut(s) 97, 162
NlaIII CATG 1 cut(s) 56
NsiI ATGCAT 1 cut(s) 151
NspI RCATGY 1 cut(s) 56
PfeI GAWTC 2 cut(s) 76, 280
PspPI GGNCC 2 cut(s) 46, 224
Sau3AI GATC 2 cut(s) 97, 162
Sau96I GGNCC 2 cut(s) 46, 224
SetI ASST 3 cut(s) 28, 89, 139
SinI GGWCC 1 cut(s) 224
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
Sse9I AATT 1 cut(s) 268
SsiI CCGC 1 cut(s) 227
SspI AATATT 1 cut(s) 308
SspMI CTAG 1 cut(s) 156
TaqI TCGA 1 cut(s) 265
TasI AATT 1 cut(s) 268
TfiI GAWTC 2 cut(s) 76, 280
VpaK11BI GGWCC 1 cut(s) 224
XapI RAATTY 1 cut(s) 268
XceI RCATGY 1 cut(s) 56
XspI CTAG 1 cut(s) 156
Zsp2I ATGCAT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.