Rmu_sc0001207.1_g000081

Methionine adenosyltransferase 2 subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001207.1
Physical Location & Seq
Reverse (-)
344953 .. 347588
2636 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001207.1_g000081.1.cds

Sequence Viewer

Length: 951 bp
atgagtaggaagagagttttggttgttggaggcacaggttacttgggacagcatgtattgcaaggctttgcagagattcaagaaaccactccttgtgatctggcatttacccaccactcaagtcctcctccccaagctttgctcaatgcatttcctagcgtgatgcctttctctgtggatttgaagtctggcaatggatttgaagccatttctcatctgtttggtccgcctgatgtggtagtaaactgtgctgcactttcggttcctcgtgcctgtgaaatggatcctgctgcagctatgtcagttaatgtgccatctactcttgttaattggttatcgagcttagaagagagtaattatcttctgatccatttgtcaactgatcaagtttatgaaggggtgaagtccttttacaaggaagaagatgaagttgttccagtaaatgtttatgggaaatcaaaagtggcagctgagcagttcattactgagaaatgctcaaactttgcaattttgagaagcagtatcatctttgggccacagacgatctcaccagtttcaaaatctctaccgattcagtgggttgatggtgtcctctccaaaggaaatacaaccgaattctttcatgatgagtttcgatgccctgtgtatgtaaagaatgtcgtagcaatcatacttgctttgtccaaggcatggatatcagaggctaagcaaagaaaattgctactgaatgttggtggaccggacagggtatcccgtgttcaaatggctgagacagttgctgatataaggggatacaacctctcattaattaaatctgtatctgcatcatcggttgatcgtggagttatgtctcctgctgacatatccatggatataactaagctagttcagacgcttggcatttctcctatttcatttcgagatggtgtcagattgacgcttgaactgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

316

Amino Acids

34.37

Weight (kDa)

5.9

Isoelectric Point (pI)

42.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 690
AciI CCGC 1 cut(s) 227
AclWI GGATC 3 cut(s) 278, 291, 361
AcsI RAATTY 1 cut(s) 614
AfiI CCNNNNNNNGG 1 cut(s) 690
AgsI TTSAA 6 cut(s) 80, 184, 203, 558, 761, 944
AjuI GAANNNNNNNTTGG 1 cut(s) 34
AluBI AGCT 5 cut(s) 137, 296, 342, 470, 883
AluI AGCT 5 cut(s) 137, 296, 342, 470, 883
Alw26I GTCTC 2 cut(s) 764, 855
AlwI GGATC 3 cut(s) 278, 291, 361
AlwNI CAGNNNCTG 1 cut(s) 779
AoxI GGCC 1 cut(s) 533
ApeKI GCWGC 4 cut(s) 251, 290, 293, 467
ApoI RAATTY 1 cut(s) 614
AseI ATTAAT 1 cut(s) 806
Asp700I GAANNNNTTC 2 cut(s) 432, 618
AspS9I GGNCC 3 cut(s) 224, 533, 737
AsuHPI GGTGA 2 cut(s) 412, 540
AvaII GGWCC 2 cut(s) 224, 737
BamHI GGATCC 1 cut(s) 283
BarI GAAGNNNNNNTAC 2 cut(s) 395, 427
BauI CACGAG 1 cut(s) 267
BbvI GCAGC 4 cut(s) 238, 277, 305, 479
BccI CCATC 3 cut(s) 322, 578, 917
BciVI GTATCC 2 cut(s) 760, 785
BclI TGATCA 1 cut(s) 382
BcoDI GTCTC 2 cut(s) 764, 855
BfaI CTAG 2 cut(s) 156, 884
BfmI CTRYAG 1 cut(s) 291
BfuI GTATCC 2 cut(s) 760, 785
BisI GCNGC 4 cut(s) 252, 291, 294, 468
BlpI GCTNAGC 2 cut(s) 471, 705
BlsI GCNGC 4 cut(s) 253, 292, 295, 469
Bme18I GGWCC 2 cut(s) 224, 737
BmgT120I GGNCC 3 cut(s) 224, 533, 737
BmiI GGNNCC 2 cut(s) 264, 285
BmsI GCATC 3 cut(s) 153, 626, 833
BplI GAGNNNNNCTC 2 cut(s) 479, 511
Bpu1102I GCTNAGC 2 cut(s) 471, 705
BpuEI CTTGAG 1 cut(s) 103
BsaJI CCNNGG 2 cut(s) 684, 867
BsaWI WCCGGW 1 cut(s) 739
Bsc4I CCNNNNNNNGG 1 cut(s) 690
Bse1I ACTGG 2 cut(s) 437, 551
Bse3DI GCAATG 1 cut(s) 199
BseDI CCNNGG 2 cut(s) 684, 867
BseLI CCNNNNNNNGG 1 cut(s) 690
BseMI GCAATG 1 cut(s) 199
BseMII CTCAG 3 cut(s) 462, 477, 759
BseNI ACTGG 2 cut(s) 437, 551
BseRI GAGGAG 1 cut(s) 117
BseXI GCAGC 4 cut(s) 238, 277, 305, 479
BsgI GTGCAG 1 cut(s) 237
BshFI GGCC 1 cut(s) 535
BsiSI CCGG 1 cut(s) 740
BslFI GGGAC 1 cut(s) 60
BslI CCNNNNNNNGG 1 cut(s) 690
BsmAI GTCTC 2 cut(s) 764, 855
BsmFI GGGAC 1 cut(s) 60
BsnI GGCC 1 cut(s) 535
Bsp143I GATC 6 cut(s) 97, 283, 366, 382, 543, 835
Bsp1720I GCTNAGC 2 cut(s) 471, 705
Bsp19I CCATGG 1 cut(s) 867
BspACI CCGC 1 cut(s) 227
BspANI GGCC 1 cut(s) 535
BspCNI CTCAG 3 cut(s) 463, 478, 760
BspHI TCATGA 1 cut(s) 622
BspLI GGNNCC 2 cut(s) 264, 285
BspMAI CTGCAG 1 cut(s) 295
BspPI GGATC 3 cut(s) 278, 291, 361
BsrDI GCAATG 1 cut(s) 199
BsrI ACTGG 2 cut(s) 437, 551
BssECI CCNNGG 2 cut(s) 684, 867
BssMI GATC 6 cut(s) 97, 283, 366, 382, 543, 835
BssSI CACGAG 1 cut(s) 267
BssT1I CCWWGG 2 cut(s) 684, 867
Bst2BI CACGAG 1 cut(s) 267
Bst4CI ACNGT 3 cut(s) 248, 775, 948
Bst6I CTCTTC 2 cut(s) 5, 342
BstAPI GCANNNNNTGC 1 cut(s) 58
BstDEI CTNAG 6 cut(s) 343, 471, 486, 705, 768, 879
BstDSI CCRYGG 1 cut(s) 867
BstKTI GATC 6 cut(s) 100, 286, 369, 385, 546, 838
BstMAI GTCTC 2 cut(s) 764, 855
BstMBI GATC 6 cut(s) 97, 283, 366, 382, 543, 835
BstMWI GCNNNNNNNGC 1 cut(s) 58
BstNSI RCATGY 1 cut(s) 56
BstSFI CTRYAG 1 cut(s) 291
BstV1I GCAGC 4 cut(s) 238, 277, 305, 479
BstX2I RGATCY 1 cut(s) 283
BstYI RGATCY 1 cut(s) 283
BsuI GTATCC 2 cut(s) 760, 785
BsuRI GGCC 1 cut(s) 535
BtgI CCRYGG 1 cut(s) 867
BtsIMutI CAGTG 1 cut(s) 581
CaiI CAGNNNCTG 1 cut(s) 779
CciI TCATGA 1 cut(s) 622
Cfr13I GGNCC 3 cut(s) 224, 533, 737
CseI GACGC 2 cut(s) 901, 946
CviAII CATG 4 cut(s) 53, 623, 690, 868
DdeI CTNAG 6 cut(s) 343, 471, 486, 705, 768, 879
DpnI GATC 6 cut(s) 99, 285, 368, 384, 545, 837
DpnII GATC 6 cut(s) 97, 283, 366, 382, 543, 835
Eam1104I CTCTTC 2 cut(s) 5, 342
EarI CTCTTC 2 cut(s) 5, 342
EciI GGCGGA 1 cut(s) 216
Eco130I CCWWGG 2 cut(s) 684, 867
Eco32I GATATC 1 cut(s) 696
Eco47I GGWCC 2 cut(s) 224, 737
EcoRI GAATTC 1 cut(s) 614
EcoRV GATATC 1 cut(s) 696
EcoT14I CCWWGG 2 cut(s) 684, 867
EcoT22I ATGCAT 1 cut(s) 151
ErhI CCWWGG 2 cut(s) 684, 867
FaeI CATG 4 cut(s) 56, 626, 693, 871
FaqI GGGAC 1 cut(s) 60
FatI CATG 4 cut(s) 52, 622, 689, 867
FbaI TGATCA 1 cut(s) 382
Fnu4HI GCNGC 4 cut(s) 252, 291, 294, 468
Fsp4HI GCNGC 4 cut(s) 252, 291, 294, 468
FspBI CTAG 2 cut(s) 156, 884
GluI GCNGC 4 cut(s) 252, 291, 294, 468
HaeIII GGCC 1 cut(s) 535
HapII CCGG 1 cut(s) 740
HgaI GACGC 2 cut(s) 901, 946
Hin1II CATG 4 cut(s) 56, 626, 693, 871
HincII GTYRAC 1 cut(s) 378
HindII GTYRAC 1 cut(s) 378
HindIII AAGCTT 1 cut(s) 135
HinfI GANTC 2 cut(s) 76, 571
HpaII CCGG 1 cut(s) 740
HphI GGTGA 2 cut(s) 412, 540
Hpy166II GTNNAC 3 cut(s) 244, 378, 737
Hpy188I TCNGA 4 cut(s) 366, 700, 891, 932
Hpy188III TCNNGA 3 cut(s) 80, 623, 920
Hpy8I GTNNAC 3 cut(s) 244, 378, 737
HpyAV CCTTC 1 cut(s) 389
HpyCH4III ACNGT 3 cut(s) 248, 775, 948
HpyCH4V TGCA 7 cut(s) 61, 71, 149, 254, 293, 506, 824
HpyF10VI GCNNNNNNNGC 1 cut(s) 58
HpyF3I CTNAG 6 cut(s) 343, 471, 486, 705, 768, 879
Hsp92II CATG 4 cut(s) 56, 626, 693, 871
Ksp22I TGATCA 1 cut(s) 382
Kzo9I GATC 6 cut(s) 97, 283, 366, 382, 543, 835
Lsp1109I GCAGC 4 cut(s) 238, 277, 305, 479
LweI GCATC 3 cut(s) 153, 626, 833
MaeI CTAG 2 cut(s) 156, 884
MaeIII GTNAC 1 cut(s) 38
MalI GATC 6 cut(s) 99, 285, 368, 384, 545, 837
MboI GATC 6 cut(s) 97, 283, 366, 382, 543, 835
MboII GAAGA 5 cut(s) 22, 353, 359, 431, 434
MflI RGATCY 1 cut(s) 283
MluCI AATT 6 cut(s) 328, 355, 507, 614, 716, 807
MmeI TCCRAC 1 cut(s) 7
MnlI CCTC 7 cut(s) 23, 135, 138, 276, 602, 694, 809
Mph1103I ATGCAT 1 cut(s) 151
MroXI GAANNNNTTC 2 cut(s) 432, 618
MseI TTAA 4 cut(s) 306, 327, 806, 810
MslI CAYNNNNRTG 1 cut(s) 866
MspA1I CMGCKG 1 cut(s) 470
MspI CCGG 1 cut(s) 740
MwoI GCNNNNNNNGC 1 cut(s) 58
NcoI CCATGG 1 cut(s) 867
NdeII GATC 6 cut(s) 97, 283, 366, 382, 543, 835
NlaIII CATG 4 cut(s) 56, 626, 693, 871
NlaIV GGNNCC 2 cut(s) 264, 285
NsiI ATGCAT 1 cut(s) 151
NspI RCATGY 1 cut(s) 56
PacI TTAATTAA 1 cut(s) 810
PagI TCATGA 1 cut(s) 622
PdmI GAANNNNTTC 2 cut(s) 432, 618
PfeI GAWTC 2 cut(s) 76, 571
PflMI CCANNNNNTGG 1 cut(s) 690
PkrI GCNGC 4 cut(s) 253, 292, 295, 469
PshBI ATTAAT 1 cut(s) 806
PspN4I GGNNCC 2 cut(s) 264, 285
PspPI GGNCC 3 cut(s) 224, 533, 737
PsrI GAACNNNNNNTAC 2 cut(s) 741, 773
PstI CTGCAG 1 cut(s) 295
PstNI CAGNNNCTG 1 cut(s) 779
PsuI RGATCY 1 cut(s) 283
PvuII CAGCTG 1 cut(s) 470
RseI CAYNNNNRTG 1 cut(s) 866
SaqAI TTAA 4 cut(s) 306, 327, 806, 810
SatI GCNGC 4 cut(s) 252, 291, 294, 468
Sau3AI GATC 6 cut(s) 97, 283, 366, 382, 543, 835
Sau96I GGNCC 3 cut(s) 224, 533, 737
SetI ASST 7 cut(s) 40, 139, 298, 344, 472, 801, 885
SfaNI GCATC 3 cut(s) 153, 626, 833
SfcI CTRYAG 1 cut(s) 291
SinI GGWCC 2 cut(s) 224, 737
SmiMI CAYNNNNRTG 1 cut(s) 866
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
Sse9I AATT 6 cut(s) 328, 355, 507, 614, 716, 807
SsiI CCGC 1 cut(s) 227
SspMI CTAG 2 cut(s) 156, 884
StyI CCWWGG 2 cut(s) 684, 867
TaaI ACNGT 3 cut(s) 248, 775, 948
TaqI TCGA 3 cut(s) 338, 634, 919
TasI AATT 6 cut(s) 328, 355, 507, 614, 716, 807
TfiI GAWTC 2 cut(s) 76, 571
Tru1I TTAA 4 cut(s) 306, 327, 806, 810
Tru9I TTAA 4 cut(s) 306, 327, 806, 810
TscAI CASTG 1 cut(s) 581
TseI GCWGC 4 cut(s) 251, 290, 293, 467
TspDTI ATGAA 5 cut(s) 408, 441, 469, 611, 903
TspRI CASTG 1 cut(s) 581
Van91I CCANNNNNTGG 1 cut(s) 690
VpaK11BI GGWCC 2 cut(s) 224, 737
VspI ATTAAT 1 cut(s) 806
XapI RAATTY 1 cut(s) 614
XceI RCATGY 1 cut(s) 56
XmnI GAANNNNTTC 2 cut(s) 432, 618
XspI CTAG 2 cut(s) 156, 884
Zsp2I ATGCAT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.