Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0001939

Physical Location & Seq

Genomic Coordinates Forward (+)

67757697 .. 67760736

Gene Structure 3040 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ60639

Sequence Viewer

CDS Protein Promoter (2k)

Length: 156 bp

ATGAATAGAGAGTGGATTCATTCTAAAAACAAACTCAGCCAAGAATACAAGGATGGTATTCAGTCTTTCATTGAATTAAGGGAGACTTTGCTTTCTTATCTTATCAAAATCACAACTGCTTATTGTCTCTGGATCGATATGTGGCTAGGAGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

51

Amino Acids

6.21

Weight (kDa)

5.71

Isoelectric Point (pI)

45.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001939)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G092800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0383451 RchiOBHm_Chr2g0125501 RchiOBHm_Chr2g0171631 RchiOBHm_Chr2g0171641 RchiOBHm_Chr5g0011851 RchiOBHm_Chr5g0025001 RchiOBHm_Chr6g0253951
rosa_laevigata	RLG00000010447 RLG00000022025 RLG00000033319
rosa_multiflora	Rmu_co8441523.1_g000001 Rmu_sc0000012.1_g000008 Rmu_sc0001552.1_g000047 Rmu_sc0003158.1_g000011 Rmu_sc0003314.1_g000040 Rmu_sc0004347.1_g000014 Rmu_sc0005457.1_g000012 Rmu_sc0005523.1_g000007 Rmu_sc0006806.1_g000031
rosa_roxburghii	Rroxscaffold_1G00003330 Rroxscaffold_1G00058450 Rroxscaffold_2G00080560 Rroxscaffold_3G00249960 Rroxscaffold_3G00250370 Rroxscaffold_5G00347440
rosa_rugosa	Rorug02G0501200 Rorug04G0073700 Rorug05G0106400 Rorug07G0308700
rosa_samantha	Rh1AG212100 Rh2AG406200 Rh2AG629800 Rh2BG224700 Rh2BG640400 Rh2BG642700 Rh2CG608800 Rh2CG608900 Rh2DG651300 Rh2DG657000 Rh4DG354700 Rh5BG072900 Rh5BG370300 Rh5CG214900 Rh6BG397100 Rh7CG378700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	140
AgsI	TTSAA	1 cut(s)	74
Alw26I	GTCTC	2 cut(s)	77, 131
AlwI	GGATC	1 cut(s)	140
BccI	CCATC	1 cut(s)	47
BcoDI	GTCTC	2 cut(s)	77, 131
BfaI	CTAG	1 cut(s)	146
Bsa29I	ATCGAT	1 cut(s)	135
BseCI	ATCGAT	1 cut(s)	135
BseGI	GGATG	1 cut(s)	58
BseMII	CTCAG	1 cut(s)	49
BshVI	ATCGAT	1 cut(s)	135
BsmAI	GTCTC	2 cut(s)	77, 131
Bsp143I	GATC	1 cut(s)	132
BspCNI	CTCAG	1 cut(s)	48
BspDI	ATCGAT	1 cut(s)	135
BspPI	GGATC	1 cut(s)	140
BssMI	GATC	1 cut(s)	132
BstDEI	CTNAG	1 cut(s)	35
BstF5I	GGATG	1 cut(s)	58
BstKTI	GATC	1 cut(s)	135
BstMAI	GTCTC	2 cut(s)	77, 131
BstMBI	GATC	1 cut(s)	132
Bsu15I	ATCGAT	1 cut(s)	135
BsuTUI	ATCGAT	1 cut(s)	135
BtsCI	GGATG	1 cut(s)	58
ClaI	ATCGAT	1 cut(s)	135
CviJI	RGCY	2 cut(s)	39, 145
CviKI_1	RGCY	2 cut(s)	39, 145
DdeI	CTNAG	1 cut(s)	35
DpnI	GATC	1 cut(s)	134
DpnII	GATC	1 cut(s)	132
FaiI	YATR	1 cut(s)	140
FalI	AAGNNNNNCTT	2 cut(s)	70, 102
FokI	GGATG	1 cut(s)	65
FspBI	CTAG	1 cut(s)	146
FspEI	CC	8 cut(s)	35, 39, 53, 64, 65, 115, 127, 132
HinfI	GANTC	1 cut(s)	16
Hpy188III	TCNNGA	1 cut(s)	130
HpyF3I	CTNAG	1 cut(s)	35
Kzo9I	GATC	1 cut(s)	132
LpnPI	CCDG	1 cut(s)	115
MaeI	CTAG	1 cut(s)	146
MalI	GATC	1 cut(s)	134
MboI	GATC	1 cut(s)	132
MluCI	AATT	1 cut(s)	74
MseI	TTAA	1 cut(s)	77
NdeII	GATC	1 cut(s)	132
PfeI	GAWTC	1 cut(s)	16
SaqAI	TTAA	1 cut(s)	77
Sau3AI	GATC	1 cut(s)	132
SgeI	CNNG	3 cut(s)	53, 61, 142
Sse9I	AATT	1 cut(s)	74
SspMI	CTAG	1 cut(s)	146
TaqI	TCGA	1 cut(s)	135
TasI	AATT	1 cut(s)	74
TfiI	GAWTC	1 cut(s)	16
Tru1I	TTAA	1 cut(s)	77
Tru9I	TTAA	1 cut(s)	77
TspDTI	ATGAA	3 cut(s)	8, 17, 58
XspI	CTAG	1 cut(s)	146

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.