Rh2BG640400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
85982309 .. 85982611
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG640400.1

Sequence Viewer

Length: 303 bp
ATGGATGTAGACATGATTTGTGCTTTTGAAAGAAACTTACTTGCAGTAAAATTGCTGCCTTCTGGATATGAGGACAGTGACAATTCCCACAGGAAGAACATGCATTTCTACACATGTAGCTGCTATCTGAAGGATGTAAGATCATTCAGAAGGGGGAAAGGAAAATTCAAAGTGAGGAGTGAGGACGACATTAGTACATCATTCATAAATACTCAACAGCCATGTTTAATTCATATTACTAAGGAAAAAAAAAACATAAAAATGGAAGTGTTTGAGGATATTCTTTGCTGTAGTTCCTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.7

Weight (kDa)

8.22

Isoelectric Point (pI)

58.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 9
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 149
AfaI GTAC 1 cut(s) 196
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 29, 169
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
ApeKI GCWGC 2 cut(s) 55, 120
ApoI RAATTY 1 cut(s) 164
BbvI GCAGC 2 cut(s) 42, 107
BfmI CTRYAG 1 cut(s) 289
BisI GCNGC 2 cut(s) 56, 121
BlsI GCNGC 2 cut(s) 57, 122
BseGI GGATG 2 cut(s) 10, 139
BseRI GAGGAG 1 cut(s) 190
BseXI GCAGC 2 cut(s) 42, 107
Bsp143I GATC 1 cut(s) 140
BssMI GATC 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 2 cut(s) 10, 139
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
BstNSI RCATGY 2 cut(s) 103, 117
BstSFI CTRYAG 1 cut(s) 289
BstV1I GCAGC 2 cut(s) 42, 107
BtsCI GGATG 2 cut(s) 10, 139
BtsIMutI CAGTG 1 cut(s) 82
Csp6I GTAC 1 cut(s) 195
CviAII CATG 4 cut(s) 13, 100, 114, 222
CviJI RGCY 2 cut(s) 120, 220
CviKI_1 RGCY 2 cut(s) 120, 220
CviQI GTAC 1 cut(s) 195
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 105
FaeI CATG 4 cut(s) 16, 103, 117, 225
FaiI YATR 8 cut(s) 14, 69, 101, 115, 206, 223, 234, 257
FatI CATG 4 cut(s) 12, 99, 113, 221
FblI GTMKAC 1 cut(s) 9
Fnu4HI GCNGC 2 cut(s) 56, 121
FokI GGATG 2 cut(s) 17, 146
Fsp4HI GCNGC 2 cut(s) 56, 121
GluI GCNGC 2 cut(s) 56, 121
Hin1II CATG 4 cut(s) 16, 103, 117, 225
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 2 cut(s) 129, 149
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 69, 124, 144
HpyCH4III ACNGT 1 cut(s) 77
HpyCH4V TGCA 2 cut(s) 44, 103
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 4 cut(s) 16, 103, 117, 225
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 2 cut(s) 48, 76
Lsp1109I GCAGC 2 cut(s) 42, 107
MaeIII GTNAC 1 cut(s) 77
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 1 cut(s) 106
MluCI AATT 4 cut(s) 50, 82, 164, 228
MnlI CCTC 4 cut(s) 64, 168, 175, 268
Mph1103I ATGCAT 1 cut(s) 105
MseI TTAA 2 cut(s) 227, 301
MslI CAYNNNNRTG 1 cut(s) 260
NdeII GATC 1 cut(s) 140
NlaIII CATG 4 cut(s) 16, 103, 117, 225
NmuCI GTSAC 1 cut(s) 77
NsiI ATGCAT 1 cut(s) 105
NspI RCATGY 2 cut(s) 103, 117
PciI ACATGT 1 cut(s) 113
PkrI GCNGC 2 cut(s) 57, 122
PscI ACATGT 1 cut(s) 113
RsaI GTAC 1 cut(s) 196
RsaNI GTAC 1 cut(s) 195
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 2 cut(s) 227, 301
SatI GCNGC 2 cut(s) 56, 121
Sau3AI GATC 1 cut(s) 140
SetI ASST 1 cut(s) 122
SfcI CTRYAG 1 cut(s) 289
SgeI CNNG 7 cut(s) 25, 53, 75, 103, 112, 126, 234
SmiMI CAYNNNNRTG 1 cut(s) 260
Sse9I AATT 4 cut(s) 50, 82, 164, 228
TaaI ACNGT 1 cut(s) 77
TasI AATT 4 cut(s) 50, 82, 164, 228
TatI WGTACW 1 cut(s) 194
Tru1I TTAA 2 cut(s) 227, 301
Tru9I TTAA 2 cut(s) 227, 301
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 77
TseI GCWGC 2 cut(s) 55, 120
Tsp45I GTSAC 1 cut(s) 77
TspDTI ATGAA 2 cut(s) 193, 221
TspRI CASTG 1 cut(s) 82
XapI RAATTY 1 cut(s) 164
XceI RCATGY 2 cut(s) 103, 117
XmiI GTMKAC 1 cut(s) 9
Zsp2I ATGCAT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.