RchiOBHm_Chr6g0253951

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001939
Physical Location & Seq
Reverse (-)
9066091 .. 9069176
3086 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22775

Sequence Viewer

Length: 159 bp
ATGTTCATGTGCTTTTCCATTTTGGTGCAGTGTTGTTTCCGAAGTAAGTTATGTACAAAGTTTGAGAAAAATTGCAAGATCTGCTGGAGTAACGTGATAATAGAGCACAGCCAAGCCATTTTGAACTCTTTGTACTCATTTTTACTGGGACTTGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.07

Weight (kDa)

8.28

Isoelectric Point (pI)

41.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 55, 134
AgsI TTSAA 1 cut(s) 124
Alw21I GWGCWC 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 108
BfaI CTAG 1 cut(s) 157
BglII AGATCT 1 cut(s) 78
BmrI ACTGGG 1 cut(s) 155
BmuI ACTGGG 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 106
Bse1I ACTGG 1 cut(s) 150
BseNI ACTGG 1 cut(s) 150
BsgI GTGCAG 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 108
Bsp1407I TGTACA 1 cut(s) 53
Bsp143I GATC 1 cut(s) 78
BsrGI TGTACA 1 cut(s) 53
BsrI ACTGG 1 cut(s) 150
BssMI GATC 1 cut(s) 78
BstAPI GCANNNNNTGC 1 cut(s) 81
BstAUI TGTACA 1 cut(s) 53
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 78
BstYI RGATCY 1 cut(s) 78
BtsI GCAGTG 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 35
Csp6I GTAC 2 cut(s) 54, 133
CviAII CATG 1 cut(s) 7
CviJI RGCY 2 cut(s) 111, 116
CviKI_1 RGCY 2 cut(s) 111, 116
CviQI GTAC 2 cut(s) 54, 133
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
FaeI CATG 1 cut(s) 10
FaiI YATR 2 cut(s) 8, 52
FatI CATG 1 cut(s) 6
FspBI CTAG 1 cut(s) 157
FspEI CC 8 cut(s) 8, 31, 53, 70, 125, 130, 131, 132
GsuI CTGGAG 1 cut(s) 106
Hin1II CATG 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 41
HpyCH4IV ACGT 1 cut(s) 93
HpyCH4V TGCA 2 cut(s) 28, 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 93
Hsp92II CATG 1 cut(s) 10
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 2 cut(s) 70, 131
MaeI CTAG 1 cut(s) 157
MaeII ACGT 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 89
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MflI RGATCY 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 1 cut(s) 70
MslI CAYNNNNRTG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 81
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 10
PsrI GAACNNNNNNTAC 2 cut(s) 116, 148
PsuI RGATCY 1 cut(s) 78
RsaI GTAC 2 cut(s) 55, 134
RsaNI GTAC 2 cut(s) 54, 133
RseI CAYNNNNRTG 1 cut(s) 23
Sau3AI GATC 1 cut(s) 78
SduI GDGCHC 1 cut(s) 108
SetI ASST 1 cut(s) 96
SgeI CNNG 5 cut(s) 19, 88, 97, 106, 125
SmiMI CAYNNNNRTG 1 cut(s) 23
Sse9I AATT 1 cut(s) 70
SspMI CTAG 1 cut(s) 157
TaiI ACGT 1 cut(s) 96
TasI AATT 1 cut(s) 70
TatI WGTACW 2 cut(s) 53, 132
TscAI CASTG 1 cut(s) 35
TspRI CASTG 1 cut(s) 35
XspI CTAG 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.