Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004347.1

Orthogroup ID

OG0001939

Physical Location & Seq

Genomic Coordinates Forward (+)

49390 .. 49965

Gene Structure 576 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004347.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 576 bp

atggatagggtgtggattcagtggggtttagatccaaattatcggtttactattgcgtttaaagaaggggttaactcttttcttgaggttgcgaagcatcatgtgaatgcgaataatcagatctcatgtccgtgcatgcagtgcaataacacaaattcacaccctttaaccgtggccaagatccatttattgaaaaatggcatggtaacaacatataacccatggatatatcacggagaacagaatgaagtgcggagtcaaactattccgaataccccaattgatgcatctgaacacaatacaggtatttttgatatgatgaacgatctttttccaatcggtaatgcacatgtaacgggtgatagagatgatataggggaggatgaagacgactatatagatgatacatcaggaaatcaggatacccaaggggcttacgatactatcggtgttcataatgaagataaggataactacgataagttattgcaagaagctgaacgagaactctaccctggttgcacagaatattcagttttaacattttgttgtggagttgattcactgcaaagttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4218 Transpos_assoc Transposase_21

Protein Analysis

191

Amino Acids

21.61

Weight (kDa)

4.41

Isoelectric Point (pI)

23.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001939)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G092800_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0383451 RchiOBHm_Chr2g0125501 RchiOBHm_Chr2g0171631 RchiOBHm_Chr2g0171641 RchiOBHm_Chr5g0011851 RchiOBHm_Chr5g0025001 RchiOBHm_Chr6g0253951
rosa_laevigata	RLG00000010447 RLG00000022025 RLG00000033319
rosa_multiflora	Rmu_co8441523.1_g000001 Rmu_sc0000012.1_g000008 Rmu_sc0001552.1_g000047 Rmu_sc0003158.1_g000011 Rmu_sc0003314.1_g000040 Rmu_sc0004347.1_g000014 Rmu_sc0005457.1_g000012 Rmu_sc0005523.1_g000007 Rmu_sc0006806.1_g000031
rosa_roxburghii	Rroxscaffold_1G00003330 Rroxscaffold_1G00058450 Rroxscaffold_2G00080560 Rroxscaffold_3G00249960 Rroxscaffold_3G00250370 Rroxscaffold_5G00347440
rosa_rugosa	Rorug02G0501200 Rorug04G0073700 Rorug05G0106400 Rorug07G0308700
rosa_samantha	Rh1AG212100 Rh2AG406200 Rh2AG629800 Rh2BG224700 Rh2BG640400 Rh2BG642700 Rh2CG608800 Rh2CG608900 Rh2DG651300 Rh2DG657000 Rh4DG354700 Rh5BG072900 Rh5BG370300 Rh5CG214900 Rh6BG397100 Rh7CG378700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	253
AclWI	GGATC	2 cut(s)	26, 175
AcoI	YGGCCR	1 cut(s)	174
AcsI	RAATTY	1 cut(s)	154
AflIII	ACRYGT	1 cut(s)	349
AgsI	TTSAA	1 cut(s)	193
AjnI	CCWGG	1 cut(s)	514
AluBI	AGCT	1 cut(s)	497
AluI	AGCT	1 cut(s)	497
AlwI	GGATC	2 cut(s)	26, 175
AoxI	GGCC	1 cut(s)	174
ApoI	RAATTY	1 cut(s)	154
AsuHPI	GGTGA	1 cut(s)	371
BalI	TGGCCA	1 cut(s)	176
BbsI	GAAGAC	1 cut(s)	393
BciT130I	CCWGG	1 cut(s)	516
BciVI	GTATCC	1 cut(s)	415
BfuI	GTATCC	1 cut(s)	415
BglII	AGATCT	1 cut(s)	120
Bme1390I	CCNGG	1 cut(s)	516
BmrFI	CCNGG	1 cut(s)	516
BmsI	GCATC	3 cut(s)	106, 274, 296
BpiI	GAAGAC	1 cut(s)	393
BpuEI	CTTGAG	1 cut(s)	104
BsaJI	CCNNGG	4 cut(s)	171, 221, 427, 514
BseBI	CCWGG	1 cut(s)	516
BseDI	CCNNGG	4 cut(s)	171, 221, 427, 514
BseGI	GGATG	1 cut(s)	388
BshFI	GGCC	1 cut(s)	176
BsmI	GAATGC	1 cut(s)	112
BsnI	GGCC	1 cut(s)	176
Bsp143I	GATC	4 cut(s)	31, 120, 180, 325
Bsp19I	CCATGG	1 cut(s)	221
BspACI	CCGC	1 cut(s)	253
BspANI	GGCC	1 cut(s)	176
BspPI	GGATC	2 cut(s)	26, 175
BssECI	CCNNGG	4 cut(s)	171, 221, 427, 514
BssMI	GATC	4 cut(s)	31, 120, 180, 325
BssT1I	CCWWGG	2 cut(s)	221, 427
Bst2UI	CCWGG	1 cut(s)	516
Bst4CI	ACNGT	1 cut(s)	172
BstAPI	GCANNNNNTGC	1 cut(s)	141
BstC8I	GCNNGC	1 cut(s)	137
BstDSI	CCRYGG	2 cut(s)	171, 221
BstF5I	GGATG	1 cut(s)	388
BstKTI	GATC	4 cut(s)	34, 123, 183, 328
BstMBI	GATC	4 cut(s)	31, 120, 180, 325
BstMWI	GCNNNNNNNGC	1 cut(s)	141
BstNI	CCWGG	1 cut(s)	516
BstNSI	RCATGY	2 cut(s)	139, 353
BstSCI	CCNGG	1 cut(s)	514
BstV2I	GAAGAC	1 cut(s)	393
BstX2I	RGATCY	3 cut(s)	31, 120, 180
BstYI	RGATCY	3 cut(s)	31, 120, 180
BsuI	GTATCC	1 cut(s)	415
BsuRI	GGCC	1 cut(s)	176
BtgI	CCRYGG	2 cut(s)	171, 221
BtsCI	GGATG	1 cut(s)	388
BtsI	GCAGTG	2 cut(s)	146, 563
BtsIMutI	CAGTG	3 cut(s)	26, 146, 563
Cac8I	GCNNGC	1 cut(s)	137
CviAII	CATG	6 cut(s)	101, 126, 136, 202, 222, 350
CviJI	RGCY	3 cut(s)	176, 434, 497
CviKI_1	RGCY	3 cut(s)	176, 434, 497
DpnI	GATC	4 cut(s)	33, 122, 182, 327
DpnII	GATC	4 cut(s)	31, 120, 180, 325
DraI	TTTAAA	1 cut(s)	61
EaeI	YGGCCR	1 cut(s)	174
Eco130I	CCWWGG	2 cut(s)	221, 427
EcoRII	CCWGG	1 cut(s)	514
EcoT14I	CCWWGG	2 cut(s)	221, 427
EcoT22I	ATGCAT	1 cut(s)	289
ErhI	CCWWGG	2 cut(s)	221, 427
FaeI	CATG	6 cut(s)	104, 129, 139, 205, 225, 353
FatI	CATG	6 cut(s)	100, 125, 135, 201, 221, 349
FokI	GGATG	1 cut(s)	395
HaeIII	GGCC	1 cut(s)	176
Hin1II	CATG	6 cut(s)	104, 129, 139, 205, 225, 353
HincII	GTYRAC	1 cut(s)	73
HindII	GTYRAC	1 cut(s)	73
HinfI	GANTC	3 cut(s)	16, 256, 560
HpaI	GTTAAC	1 cut(s)	73
HphI	GGTGA	1 cut(s)	371
Hpy166II	GTNNAC	2 cut(s)	48, 73
Hpy188I	TCNGA	3 cut(s)	120, 270, 292
Hpy188III	TCNNGA	3 cut(s)	83, 411, 419
Hpy8I	GTNNAC	2 cut(s)	48, 73
HpyAV	CCTTC	1 cut(s)	59
HpyCH4III	ACNGT	1 cut(s)	172
HpyCH4V	TGCA	8 cut(s)	135, 139, 144, 287, 347, 490, 522, 568
HpyF10VI	GCNNNNNNNGC	1 cut(s)	141
Hsp92II	CATG	6 cut(s)	104, 129, 139, 205, 225, 353
KspAI	GTTAAC	1 cut(s)	73
Kzo9I	GATC	4 cut(s)	31, 120, 180, 325
LpnPI	CCDG	5 cut(s)	288, 396, 404, 501, 528
LweI	GCATC	3 cut(s)	106, 274, 296
MaeIII	GTNAC	2 cut(s)	205, 352
MalI	GATC	4 cut(s)	33, 122, 182, 327
MboI	GATC	4 cut(s)	31, 120, 180, 325
MboII	GAAGA	2 cut(s)	398, 473
MfeI	CAATTG	1 cut(s)	279
MflI	RGATCY	3 cut(s)	31, 120, 180
MlsI	TGGCCA	1 cut(s)	176
MluCI	AATT	3 cut(s)	37, 154, 279
MluNI	TGGCCA	1 cut(s)	176
MlyI	GAGTC	1 cut(s)	265
MnlI	CCTC	2 cut(s)	79, 373
Mox20I	TGGCCA	1 cut(s)	176
Mph1103I	ATGCAT	1 cut(s)	289
MscI	TGGCCA	1 cut(s)	176
MseI	TTAA	4 cut(s)	60, 72, 167, 539
MslI	CAYNNNNRTG	2 cut(s)	105, 130
Msp20I	TGGCCA	1 cut(s)	176
MspR9I	CCNGG	1 cut(s)	516
MunI	CAATTG	1 cut(s)	279
Mva1269I	GAATGC	1 cut(s)	112
MvaI	CCWGG	1 cut(s)	516
MwoI	GCNNNNNNNGC	1 cut(s)	141
NcoI	CCATGG	1 cut(s)	221
NdeII	GATC	4 cut(s)	31, 120, 180, 325
NlaIII	CATG	6 cut(s)	104, 129, 139, 205, 225, 353
NsiI	ATGCAT	1 cut(s)	289
NspI	RCATGY	2 cut(s)	139, 353
PaeI	GCATGC	1 cut(s)	139
PciI	ACATGT	1 cut(s)	349
PctI	GAATGC	1 cut(s)	112
PfeI	GAWTC	2 cut(s)	16, 560
PleI	GAGTC	1 cut(s)	264
PpsI	GAGTC	1 cut(s)	264
PscI	ACATGT	1 cut(s)	349
Psp6I	CCWGG	1 cut(s)	514
PspGI	CCWGG	1 cut(s)	514
PsuI	RGATCY	3 cut(s)	31, 120, 180
RseI	CAYNNNNRTG	2 cut(s)	105, 130
SaqAI	TTAA	4 cut(s)	60, 72, 167, 539
Sau3AI	GATC	4 cut(s)	31, 120, 180, 325
SchI	GAGTC	1 cut(s)	265
ScrFI	CCNGG	1 cut(s)	516
SetI	ASST	3 cut(s)	90, 307, 499
SfaNI	GCATC	3 cut(s)	106, 274, 296
SmiMI	CAYNNNNRTG	2 cut(s)	105, 130
SmlI	CTYRAG	1 cut(s)	83
SmoI	CTYRAG	1 cut(s)	83
SphI	GCATGC	1 cut(s)	139
Sse9I	AATT	3 cut(s)	37, 154, 279
SsiI	CCGC	1 cut(s)	253
SspI	AATATT	1 cut(s)	530
StyD4I	CCNGG	1 cut(s)	514
StyI	CCWWGG	2 cut(s)	221, 427
TaaI	ACNGT	1 cut(s)	172
TasI	AATT	3 cut(s)	37, 154, 279
TfiI	GAWTC	2 cut(s)	16, 560
Tru1I	TTAA	4 cut(s)	60, 72, 167, 539
Tru9I	TTAA	4 cut(s)	60, 72, 167, 539
TscAI	CASTG	3 cut(s)	26, 146, 570
TspDTI	ATGAA	5 cut(s)	261, 335, 399, 443, 474
TspGWI	ACGGA	2 cut(s)	120, 249
TspRI	CASTG	3 cut(s)	26, 146, 570
XapI	RAATTY	1 cut(s)	154
XceI	RCATGY	2 cut(s)	139, 353
Zsp2I	ATGCAT	1 cut(s)	289

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.