Rh2BG224700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0001939
Physical Location & Seq
Forward (+)
21766199 .. 21772826
6628 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG224700.1

Sequence Viewer

Length: 195 bp
ATGGATAAGATACGAGAGATTGCTGGAGCCAATGATGTTATCCATGATATTTTGAATGATGCATTCCCACCCATTGACATGGATAACATGGGTCAAGATCTAGAGGAGGATGTGCTACAAGGAGGCAATGAAGATGTTATGGATGATCATGGGTCTCATGGGATGAGGATAACCTTCTCTATATATATGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.2

Weight (kDa)

4.11

Isoelectric Point (pI)

52.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 55
Alw26I GTCTC 1 cut(s) 159
BclI TGATCA 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 159
BfaI CTAG 1 cut(s) 101
BglII AGATCT 1 cut(s) 97
BmiI GGNNCC 1 cut(s) 28
BmsI GCATC 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 159
Bse3DI GCAATG 1 cut(s) 133
BseGI GGATG 3 cut(s) 115, 148, 168
BseMI GCAATG 1 cut(s) 133
BseRI GAGGAG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 159
BsmI GAATGC 1 cut(s) 62
Bso31I GGTCTC 1 cut(s) 159
Bsp143I GATC 2 cut(s) 97, 145
BspLI GGNNCC 1 cut(s) 28
BspTNI GGTCTC 1 cut(s) 159
BsrDI GCAATG 1 cut(s) 133
BssMI GATC 2 cut(s) 97, 145
BstF5I GGATG 3 cut(s) 115, 148, 168
BstKTI GATC 2 cut(s) 100, 148
BstMAI GTCTC 1 cut(s) 159
BstMBI GATC 2 cut(s) 97, 145
BstX2I RGATCY 1 cut(s) 97
BstXI CCANNNNNNTGG 1 cut(s) 79
BstYI RGATCY 1 cut(s) 97
BtsCI GGATG 3 cut(s) 115, 148, 168
CviAII CATG 5 cut(s) 44, 79, 88, 149, 158
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
DpnI GATC 2 cut(s) 99, 147
DpnII GATC 2 cut(s) 97, 145
Eco31I GGTCTC 1 cut(s) 159
EcoT22I ATGCAT 2 cut(s) 64, 192
FaeI CATG 5 cut(s) 47, 82, 91, 152, 161
FatI CATG 5 cut(s) 43, 78, 87, 148, 157
FbaI TGATCA 1 cut(s) 145
FokI GGATG 3 cut(s) 122, 155, 175
FspBI CTAG 1 cut(s) 101
GsuI CTGGAG 1 cut(s) 45
Hin1II CATG 5 cut(s) 47, 82, 91, 152, 161
Hpy188III TCNNGA 2 cut(s) 95, 101
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 2 cut(s) 62, 190
Hsp92II CATG 5 cut(s) 47, 82, 91, 152, 161
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 97, 145
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 1 cut(s) 9
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 101
MalI GATC 2 cut(s) 99, 147
MboI GATC 2 cut(s) 97, 145
MboII GAAGA 1 cut(s) 143
MflI RGATCY 1 cut(s) 97
MnlI CCTC 4 cut(s) 97, 100, 116, 159
Mph1103I ATGCAT 2 cut(s) 64, 192
MslI CAYNNNNRTG 1 cut(s) 77
Mva1269I GAATGC 1 cut(s) 62
NdeII GATC 2 cut(s) 97, 145
NlaIII CATG 5 cut(s) 47, 82, 91, 152, 161
NlaIV GGNNCC 1 cut(s) 28
NsiI ATGCAT 2 cut(s) 64, 192
PctI GAATGC 1 cut(s) 62
PspN4I GGNNCC 1 cut(s) 28
PsuI RGATCY 1 cut(s) 97
RseI CAYNNNNRTG 1 cut(s) 77
Sau3AI GATC 2 cut(s) 97, 145
SetI ASST 1 cut(s) 176
SfaNI GCATC 1 cut(s) 49
SmiMI CAYNNNNRTG 1 cut(s) 77
SspMI CTAG 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 144
XbaI TCTAGA 1 cut(s) 100
XspI CTAG 1 cut(s) 101
Zsp2I ATGCAT 2 cut(s) 64, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.