RchiOBHm_Chr2g0171641

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001939
Physical Location & Seq
Reverse (-)
85236914 .. 85240230
3317 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53902

Sequence Viewer

Length: 174 bp
ATGGATGTAGACATGATTTGTGCTTTTGAAAGAAACTTACTTGAAGTAAAATTGCTGCCTTCTGGATATGAGGACAGTGACAATTCCCACAGGAAGAACATGCATTTCTACACATGTAGCTGCTATCTGAAGGATGTAAGATCATTCAGAAGGGGGAAAGGAAATACAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.72

Weight (kDa)

8.54

Isoelectric Point (pI)

45.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 9
AcuI CTGAAG 1 cut(s) 149
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 29, 44
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
ApeKI GCWGC 2 cut(s) 55, 120
BbvI GCAGC 2 cut(s) 42, 107
BisI GCNGC 2 cut(s) 56, 121
BlsI GCNGC 2 cut(s) 57, 122
BseGI GGATG 2 cut(s) 10, 139
BseXI GCAGC 2 cut(s) 42, 107
Bsp143I GATC 1 cut(s) 140
BssMI GATC 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 77
BstF5I GGATG 2 cut(s) 10, 139
BstKTI GATC 1 cut(s) 143
BstMBI GATC 1 cut(s) 140
BstNSI RCATGY 2 cut(s) 103, 117
BstV1I GCAGC 2 cut(s) 42, 107
BtsCI GGATG 2 cut(s) 10, 139
BtsIMutI CAGTG 1 cut(s) 82
CviAII CATG 3 cut(s) 13, 100, 114
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 105
FaeI CATG 3 cut(s) 16, 103, 117
FaiI YATR 4 cut(s) 14, 69, 101, 115
FatI CATG 3 cut(s) 12, 99, 113
FblI GTMKAC 1 cut(s) 9
Fnu4HI GCNGC 2 cut(s) 56, 121
FokI GGATG 2 cut(s) 17, 146
Fsp4HI GCNGC 2 cut(s) 56, 121
GluI GCNGC 2 cut(s) 56, 121
Hin1II CATG 3 cut(s) 16, 103, 117
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 2 cut(s) 129, 149
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 69, 124, 144
HpyCH4III ACNGT 1 cut(s) 77
HpyCH4V TGCA 1 cut(s) 103
Hsp92II CATG 3 cut(s) 16, 103, 117
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 2 cut(s) 48, 76
Lsp1109I GCAGC 2 cut(s) 42, 107
MaeIII GTNAC 1 cut(s) 77
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 1 cut(s) 106
MluCI AATT 2 cut(s) 50, 82
MnlI CCTC 1 cut(s) 64
Mph1103I ATGCAT 1 cut(s) 105
NdeII GATC 1 cut(s) 140
NlaIII CATG 3 cut(s) 16, 103, 117
NmuCI GTSAC 1 cut(s) 77
NsiI ATGCAT 1 cut(s) 105
NspI RCATGY 2 cut(s) 103, 117
PciI ACATGT 1 cut(s) 113
PkrI GCNGC 2 cut(s) 57, 122
PscI ACATGT 1 cut(s) 113
SatI GCNGC 2 cut(s) 56, 121
Sau3AI GATC 1 cut(s) 140
SetI ASST 1 cut(s) 122
SgeI CNNG 6 cut(s) 25, 53, 75, 103, 112, 126
Sse9I AATT 2 cut(s) 50, 82
TaaI ACNGT 1 cut(s) 77
TasI AATT 2 cut(s) 50, 82
TscAI CASTG 1 cut(s) 82
TseFI GTSAC 1 cut(s) 77
TseI GCWGC 2 cut(s) 55, 120
Tsp45I GTSAC 1 cut(s) 77
TspRI CASTG 1 cut(s) 82
XceI RCATGY 2 cut(s) 103, 117
XmiI GTMKAC 1 cut(s) 9
Zsp2I ATGCAT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.