RchiOBHm_Chr5g0025001

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
19018665 .. 19020763
2099 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30469

Sequence Viewer

Length: 207 bp
ATGTTCATTTGCTTTTCCATTTTTGTGCAGTGTTGTTTCCGAAGTAAGTTCTGTACAAAGTTTGAGGTATTTAAATTGATGAATAAATTACGATATGAAAAGGAGAAATACAATGCCACACTTGTAGCTGCTTGTTTAATAGCCACAACACTTTATATATATCTTCTGGAACCGTACCCTTTGAATATATTTGTGTCTAGCTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

8.07

Weight (kDa)

8.9

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 55, 176
AgsI TTSAA 1 cut(s) 184
AluBI AGCT 2 cut(s) 128, 201
AluI AGCT 2 cut(s) 128, 201
ApeKI GCWGC 1 cut(s) 128
BbvI GCAGC 1 cut(s) 115
BfaI CTAG 1 cut(s) 198
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 171
BseXI GCAGC 1 cut(s) 115
BsgI GTGCAG 1 cut(s) 47
Bsp1407I TGTACA 1 cut(s) 53
BspLI GGNNCC 1 cut(s) 171
BsrGI TGTACA 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 174
BstAUI TGTACA 1 cut(s) 53
BstV1I GCAGC 1 cut(s) 115
BtsI GCAGTG 1 cut(s) 35
BtsIMutI CAGTG 1 cut(s) 35
Csp6I GTAC 2 cut(s) 54, 175
CviJI RGCY 3 cut(s) 128, 143, 201
CviKI_1 RGCY 3 cut(s) 128, 143, 201
CviQI GTAC 2 cut(s) 54, 175
DraI TTTAAA 1 cut(s) 73
FaiI YATR 6 cut(s) 96, 156, 158, 160, 188, 205
Fnu4HI GCNGC 1 cut(s) 129
Fsp4HI GCNGC 1 cut(s) 129
FspBI CTAG 1 cut(s) 198
GluI GCNGC 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 41
Hpy188III TCNNGA 1 cut(s) 167
HpyCH4III ACNGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 28
LpnPI CCDG 1 cut(s) 152
Lsp1109I GCAGC 1 cut(s) 115
MaeI CTAG 1 cut(s) 198
MboII GAAGA 1 cut(s) 155
MluCI AATT 2 cut(s) 74, 86
MnlI CCTC 1 cut(s) 58
MseI TTAA 2 cut(s) 72, 137
MslI CAYNNNNRTG 1 cut(s) 23
NlaIV GGNNCC 1 cut(s) 171
PkrI GCNGC 1 cut(s) 130
PspN4I GGNNCC 1 cut(s) 171
RsaI GTAC 2 cut(s) 55, 176
RsaNI GTAC 2 cut(s) 54, 175
RseI CAYNNNNRTG 1 cut(s) 23
SaqAI TTAA 2 cut(s) 72, 137
SatI GCNGC 1 cut(s) 129
SetI ASST 3 cut(s) 69, 130, 203
SgeI CNNG 3 cut(s) 134, 144, 179
SmiI ATTTAAAT 1 cut(s) 73
SmiMI CAYNNNNRTG 1 cut(s) 23
Sse9I AATT 2 cut(s) 74, 86
SspMI CTAG 1 cut(s) 198
SwaI ATTTAAAT 1 cut(s) 73
TaaI ACNGT 1 cut(s) 174
TasI AATT 2 cut(s) 74, 86
TatI WGTACW 1 cut(s) 53
Tru1I TTAA 2 cut(s) 72, 137
Tru9I TTAA 2 cut(s) 72, 137
TscAI CASTG 1 cut(s) 35
TseI GCWGC 1 cut(s) 128
TspDTI ATGAA 2 cut(s) 95, 111
TspRI CASTG 1 cut(s) 35
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.