Rmu_sc0005523.1_g000007

transposon protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005523.1
OG0001939
Physical Location & Seq
Forward (+)
29433 .. 29957
525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005523.1_g000007.1.cds

Sequence Viewer

Length: 525 bp
atggatagggaatggatacttaagcaggacaaattcagtgaagagtataaagaaggggttagatcttttatggaggttgcaaaacatcatgtgaatgagaggaatgagacaatatgtccctgcatggagtgcttgagtaaaagttggcagcctcttcatgttgctcatgtccatttgctgcatcatggaatgtcacttgcatatatgaaatggactgatcatggagaacacggagatacattgaccaccgagggtgatgagctaattgacaaacccaatagtttatttgacatgattggtgatctattccctacagaaaatgttggtgatcaacatatcatgagggatgaagatgatataatgatggatgtagataatgcatcaagggatgaagaggaaacaataaatgaaattcatttagagggtgatggtaatgaatataacagtaattatgagaagttattgttggaagctcaacgtgaaccgtaccctggttgcacagagcacacagtaccttggttgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4218 Transpos_assoc Transposase_21

Protein Analysis

174

Amino Acids

20.33

Weight (kDa)

4.58

Isoelectric Point (pI)

40.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 32, 411
AfaI GTAC 2 cut(s) 488, 513
AfiI CCNNNNNNNGG 1 cut(s) 491
AflII CTTAAG 1 cut(s) 20
AhdI GACNNNNNGTC 1 cut(s) 114
AjnI CCWGG 1 cut(s) 490
AjuI GAANNNNNNNTTGG 2 cut(s) 449, 481
AluBI AGCT 2 cut(s) 262, 473
AluI AGCT 2 cut(s) 262, 473
Alw21I GWGCWC 1 cut(s) 507
Alw26I GTCTC 1 cut(s) 101
ApeKI GCWGC 2 cut(s) 148, 178
ApoI RAATTY 2 cut(s) 32, 411
AsuHPI GGTGA 4 cut(s) 266, 311, 338, 437
Bbv12I GWGCWC 1 cut(s) 507
BbvI GCAGC 2 cut(s) 160, 165
BccI CCATC 2 cut(s) 358, 422
BciT130I CCWGG 1 cut(s) 492
BciVI GTATCC 1 cut(s) 9
BclI TGATCA 2 cut(s) 217, 328
BcoDI GTCTC 1 cut(s) 101
BfmI CTRYAG 1 cut(s) 312
BfrI CTTAAG 1 cut(s) 20
BfuI GTATCC 1 cut(s) 9
BglII AGATCT 1 cut(s) 62
BisI GCNGC 2 cut(s) 149, 179
BlsI GCNGC 2 cut(s) 150, 180
Bme1390I CCNGG 1 cut(s) 492
BmeRI GACNNNNNGTC 1 cut(s) 114
BmrFI CCNGG 1 cut(s) 492
BmsI GCATC 2 cut(s) 190, 389
BpuEI CTTGAG 1 cut(s) 154
BsaJI CCNNGG 3 cut(s) 249, 490, 515
Bsc4I CCNNNNNNNGG 1 cut(s) 491
BseBI CCWGG 1 cut(s) 492
BseDI CCNNGG 3 cut(s) 249, 490, 515
BseGI GGATG 3 cut(s) 352, 373, 394
BseLI CCNNNNNNNGG 1 cut(s) 491
BseXI GCAGC 2 cut(s) 160, 165
BsiHKAI GWGCWC 1 cut(s) 507
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 491
BsmAI GTCTC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 507
Bsp143I GATC 4 cut(s) 62, 217, 301, 328
BspHI TCATGA 1 cut(s) 339
BspTI CTTAAG 1 cut(s) 20
BssECI CCNNGG 3 cut(s) 249, 490, 515
BssMI GATC 4 cut(s) 62, 217, 301, 328
BssT1I CCWWGG 1 cut(s) 515
Bst2UI CCWGG 1 cut(s) 492
Bst4CI ACNGT 3 cut(s) 446, 486, 511
Bst6I CTCTTC 3 cut(s) 36, 159, 387
BstAFI CTTAAG 1 cut(s) 20
BstAPI GCANNNNNTGC 1 cut(s) 129
BstF5I GGATG 3 cut(s) 352, 373, 394
BstKTI GATC 4 cut(s) 65, 220, 304, 331
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 4 cut(s) 62, 217, 301, 328
BstMWI GCNNNNNNNGC 1 cut(s) 129
BstNI CCWGG 1 cut(s) 492
BstSCI CCNGG 1 cut(s) 490
BstSFI CTRYAG 1 cut(s) 312
BstV1I GCAGC 2 cut(s) 160, 165
BstX2I RGATCY 1 cut(s) 62
BstYI RGATCY 1 cut(s) 62
BsuI GTATCC 1 cut(s) 9
BtsCI GGATG 3 cut(s) 352, 373, 394
BtsIMutI CAGTG 1 cut(s) 43
CciI TCATGA 1 cut(s) 339
Csp6I GTAC 2 cut(s) 487, 512
CviAII CATG 8 cut(s) 89, 124, 158, 167, 185, 221, 292, 340
CviJI RGCY 3 cut(s) 151, 262, 473
CviKI_1 RGCY 3 cut(s) 151, 262, 473
CviQI GTAC 2 cut(s) 487, 512
DpnI GATC 4 cut(s) 64, 219, 303, 330
DpnII GATC 4 cut(s) 62, 217, 301, 328
DriI GACNNNNNGTC 1 cut(s) 114
Eam1104I CTCTTC 3 cut(s) 36, 159, 387
Eam1105I GACNNNNNGTC 1 cut(s) 114
EarI CTCTTC 3 cut(s) 36, 159, 387
Eco130I CCWWGG 1 cut(s) 515
EcoRII CCWGG 1 cut(s) 490
EcoT14I CCWWGG 1 cut(s) 515
EcoT22I ATGCAT 1 cut(s) 382
ErhI CCWWGG 1 cut(s) 515
FaeI CATG 8 cut(s) 92, 127, 161, 170, 188, 224, 295, 343
FaqI GGGAC 1 cut(s) 102
FatI CATG 8 cut(s) 88, 123, 157, 166, 184, 220, 291, 339
FbaI TGATCA 2 cut(s) 217, 328
Fnu4HI GCNGC 2 cut(s) 149, 179
FokI GGATG 3 cut(s) 359, 380, 401
Fsp4HI GCNGC 2 cut(s) 149, 179
GluI GCNGC 2 cut(s) 149, 179
Hin1II CATG 8 cut(s) 92, 127, 161, 170, 188, 224, 295, 343
HphI GGTGA 4 cut(s) 266, 311, 338, 437
Hpy166II GTNNAC 1 cut(s) 482
Hpy188III TCNNGA 1 cut(s) 340
Hpy8I GTNNAC 1 cut(s) 482
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 3 cut(s) 446, 486, 511
HpyCH4IV ACGT 1 cut(s) 478
HpyCH4V TGCA 6 cut(s) 80, 123, 181, 200, 380, 498
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
HpySE526I ACGT 1 cut(s) 478
Hsp92II CATG 8 cut(s) 92, 127, 161, 170, 188, 224, 295, 343
Ksp22I TGATCA 2 cut(s) 217, 328
Kzo9I GATC 4 cut(s) 62, 217, 301, 328
LpnPI CCDG 4 cut(s) 11, 133, 477, 504
Lsp1109I GCAGC 2 cut(s) 160, 165
LweI GCATC 2 cut(s) 190, 389
MaeII ACGT 1 cut(s) 478
MaeIII GTNAC 1 cut(s) 192
MalI GATC 4 cut(s) 64, 219, 303, 330
MboI GATC 4 cut(s) 62, 217, 301, 328
MboII GAAGA 4 cut(s) 53, 146, 362, 404
MflI RGATCY 1 cut(s) 62
MhlI GDGCHC 1 cut(s) 507
MluCI AATT 4 cut(s) 32, 264, 411, 448
MmeI TCCRAC 1 cut(s) 447
MnlI CCTC 7 cut(s) 67, 93, 162, 244, 336, 388, 415
Mph1103I ATGCAT 1 cut(s) 382
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 1 cut(s) 93
MspCI CTTAAG 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 492
MvaI CCWGG 1 cut(s) 492
MwoI GCNNNNNNNGC 1 cut(s) 129
NdeII GATC 4 cut(s) 62, 217, 301, 328
NlaIII CATG 8 cut(s) 92, 127, 161, 170, 188, 224, 295, 343
NmuCI GTSAC 1 cut(s) 192
NsiI ATGCAT 1 cut(s) 382
PagI TCATGA 1 cut(s) 339
PkrI GCNGC 2 cut(s) 150, 180
Psp6I CCWGG 1 cut(s) 490
PspGI CCWGG 1 cut(s) 490
PsuI RGATCY 1 cut(s) 62
RsaI GTAC 2 cut(s) 488, 513
RsaNI GTAC 2 cut(s) 487, 512
RseI CAYNNNNRTG 1 cut(s) 93
SaqAI TTAA 1 cut(s) 21
SatI GCNGC 2 cut(s) 149, 179
Sau3AI GATC 4 cut(s) 62, 217, 301, 328
ScrFI CCNGG 1 cut(s) 492
SduI GDGCHC 1 cut(s) 507
SetI ASST 5 cut(s) 78, 264, 475, 481, 517
SfaNI GCATC 2 cut(s) 190, 389
SfcI CTRYAG 1 cut(s) 312
SmiMI CAYNNNNRTG 1 cut(s) 93
SmlI CTYRAG 2 cut(s) 20, 133
SmoI CTYRAG 2 cut(s) 20, 133
Sse9I AATT 4 cut(s) 32, 264, 411, 448
StyD4I CCNGG 1 cut(s) 490
StyI CCWWGG 1 cut(s) 515
TaaI ACNGT 3 cut(s) 446, 486, 511
TaiI ACGT 1 cut(s) 481
TasI AATT 4 cut(s) 32, 264, 411, 448
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 192
TseI GCWGC 2 cut(s) 148, 178
Tsp45I GTSAC 1 cut(s) 192
TspDTI ATGAA 7 cut(s) 146, 221, 363, 404, 405, 423, 450
TspGWI ACGGA 1 cut(s) 246
TspRI CASTG 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 20
XapI RAATTY 2 cut(s) 32, 411
Zsp2I ATGCAT 1 cut(s) 382
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.