Rmu_sc0005457.1_g000012

transposon protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005457.1
Physical Location & Seq
Reverse (-)
61203 .. 61787
585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005457.1_g000012.1.cds

Sequence Viewer

Length: 585 bp
atggatagggagtggattcagtggggttcagatccaaattatcgatttactaatgtgtttaaagaaggggttaactcttttcttgaggttgcaaagcataatgtgaatgcgaataatcatctctcatgtctgtgtatgaagtgcaataatacaaattcacaccctttaaccgtggtcaagatccatttattgaaaaatggcatggttacaacatataacccatgggtatatcacggagaacagaataaaatgcagagtcaaactattcctaatagcccagttgatgcatctgaacacaatacaggtatttttgatatgatgaacgatttttttccaatgggtaatgcacatgtaacgggcgatggaaatgatataggggaggatgaggacgacgatttagatgatacatcaggaaatcaggataccgaaggggcttatgatactattggtgttcataatgaagataaagataactacgataagctactgcaagaagctgaacgagaactctaccctggttgtacagaatattcagttttaacatttgttgtggagttgattcactacgaagttgacaatctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

194

Amino Acids

22.07

Weight (kDa)

4.38

Isoelectric Point (pI)

26.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 26, 175
AcsI RAATTY 1 cut(s) 154
AfaI GTAC 1 cut(s) 523
AflIII ACRYGT 1 cut(s) 349
AgsI TTSAA 1 cut(s) 193
AjnI CCWGG 1 cut(s) 514
AluBI AGCT 2 cut(s) 484, 497
AluI AGCT 2 cut(s) 484, 497
AlwI GGATC 2 cut(s) 26, 175
ApoI RAATTY 1 cut(s) 154
BccI CCATC 1 cut(s) 356
BciT130I CCWGG 1 cut(s) 516
BciVI GTATCC 1 cut(s) 415
BfaI CTAG 1 cut(s) 583
BfuI GTATCC 1 cut(s) 415
Bme1390I CCNGG 1 cut(s) 516
BmrFI CCNGG 1 cut(s) 516
BmrI ACTGGG 1 cut(s) 272
BmsI GCATC 2 cut(s) 274, 296
BmuI ACTGGG 1 cut(s) 272
BpuEI CTTGAG 1 cut(s) 104
Bsa29I ATCGAT 1 cut(s) 43
BsaJI CCNNGG 3 cut(s) 171, 221, 514
Bse1I ACTGG 1 cut(s) 278
BseBI CCWGG 1 cut(s) 516
BseCI ATCGAT 1 cut(s) 43
BseDI CCNNGG 3 cut(s) 171, 221, 514
BseGI GGATG 1 cut(s) 388
BseNI ACTGG 1 cut(s) 278
BshVI ATCGAT 1 cut(s) 43
BsmI GAATGC 1 cut(s) 112
Bsp1407I TGTACA 1 cut(s) 521
Bsp143I GATC 2 cut(s) 31, 180
Bsp19I CCATGG 1 cut(s) 221
BspDI ATCGAT 1 cut(s) 43
BspPI GGATC 2 cut(s) 26, 175
BsrGI TGTACA 1 cut(s) 521
BsrI ACTGG 1 cut(s) 278
BssECI CCNNGG 3 cut(s) 171, 221, 514
BssMI GATC 2 cut(s) 31, 180
BssT1I CCWWGG 1 cut(s) 221
Bst2UI CCWGG 1 cut(s) 516
Bst4CI ACNGT 1 cut(s) 172
BstAUI TGTACA 1 cut(s) 521
BstDSI CCRYGG 2 cut(s) 171, 221
BstF5I GGATG 1 cut(s) 388
BstKTI GATC 2 cut(s) 34, 183
BstMBI GATC 2 cut(s) 31, 180
BstNI CCWGG 1 cut(s) 516
BstNSI RCATGY 1 cut(s) 353
BstSCI CCNGG 1 cut(s) 514
BstX2I RGATCY 2 cut(s) 31, 180
BstYI RGATCY 2 cut(s) 31, 180
Bsu15I ATCGAT 1 cut(s) 43
BsuI GTATCC 1 cut(s) 415
BsuTUI ATCGAT 1 cut(s) 43
BtgI CCRYGG 2 cut(s) 171, 221
BtgZI GCGATG 1 cut(s) 375
BtsCI GGATG 1 cut(s) 388
BtsIMutI CAGTG 1 cut(s) 26
ClaI ATCGAT 1 cut(s) 43
Csp6I GTAC 1 cut(s) 522
CviAII CATG 4 cut(s) 126, 202, 222, 350
CviJI RGCY 4 cut(s) 276, 434, 484, 497
CviKI_1 RGCY 4 cut(s) 276, 434, 484, 497
CviQI GTAC 1 cut(s) 522
DpnI GATC 2 cut(s) 33, 182
DpnII GATC 2 cut(s) 31, 180
DraI TTTAAA 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 514
EcoT14I CCWWGG 1 cut(s) 221
EcoT22I ATGCAT 1 cut(s) 289
ErhI CCWWGG 1 cut(s) 221
FaeI CATG 4 cut(s) 129, 205, 225, 353
FatI CATG 4 cut(s) 125, 201, 221, 349
FokI GGATG 1 cut(s) 395
FspBI CTAG 1 cut(s) 583
Hin1II CATG 4 cut(s) 129, 205, 225, 353
HincII GTYRAC 2 cut(s) 73, 574
HindII GTYRAC 2 cut(s) 73, 574
HinfI GANTC 3 cut(s) 16, 256, 559
HpaI GTTAAC 1 cut(s) 73
Hpy166II GTNNAC 2 cut(s) 73, 574
Hpy188I TCNGA 2 cut(s) 31, 292
Hpy188III TCNNGA 4 cut(s) 83, 178, 411, 419
Hpy8I GTNNAC 2 cut(s) 73, 574
Hpy99I CGWCG 1 cut(s) 395
HpyAV CCTTC 2 cut(s) 59, 422
HpyCH4III ACNGT 1 cut(s) 172
HpyCH4V TGCA 6 cut(s) 92, 144, 253, 287, 347, 490
Hsp92II CATG 4 cut(s) 129, 205, 225, 353
KspAI GTTAAC 1 cut(s) 73
Kzo9I GATC 2 cut(s) 31, 180
LpnPI CCDG 6 cut(s) 288, 291, 396, 404, 501, 528
LweI GCATC 2 cut(s) 274, 296
MaeI CTAG 1 cut(s) 583
MaeIII GTNAC 2 cut(s) 205, 352
MalI GATC 2 cut(s) 33, 182
MboI GATC 2 cut(s) 31, 180
MboII GAAGA 1 cut(s) 473
MflI RGATCY 2 cut(s) 31, 180
MluCI AATT 2 cut(s) 37, 154
MlyI GAGTC 1 cut(s) 265
MnlI CCTC 3 cut(s) 79, 373, 379
Mph1103I ATGCAT 1 cut(s) 289
MseI TTAA 4 cut(s) 60, 72, 167, 539
MslI CAYNNNNRTG 1 cut(s) 130
MspR9I CCNGG 1 cut(s) 516
Mva1269I GAATGC 1 cut(s) 112
MvaI CCWGG 1 cut(s) 516
NcoI CCATGG 1 cut(s) 221
NdeII GATC 2 cut(s) 31, 180
NlaIII CATG 4 cut(s) 129, 205, 225, 353
NsiI ATGCAT 1 cut(s) 289
NspI RCATGY 1 cut(s) 353
PciI ACATGT 1 cut(s) 349
PctI GAATGC 1 cut(s) 112
PfeI GAWTC 2 cut(s) 16, 559
PleI GAGTC 1 cut(s) 264
PpsI GAGTC 1 cut(s) 264
PscI ACATGT 1 cut(s) 349
Psp6I CCWGG 1 cut(s) 514
PspGI CCWGG 1 cut(s) 514
PsuI RGATCY 2 cut(s) 31, 180
RsaI GTAC 1 cut(s) 523
RsaNI GTAC 1 cut(s) 522
RseI CAYNNNNRTG 1 cut(s) 130
SaqAI TTAA 4 cut(s) 60, 72, 167, 539
Sau3AI GATC 2 cut(s) 31, 180
SchI GAGTC 1 cut(s) 265
ScrFI CCNGG 1 cut(s) 516
SetI ASST 4 cut(s) 90, 307, 486, 499
SfaNI GCATC 2 cut(s) 274, 296
SmiMI CAYNNNNRTG 1 cut(s) 130
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 2 cut(s) 37, 154
SspI AATATT 1 cut(s) 530
SspMI CTAG 1 cut(s) 583
StyD4I CCNGG 1 cut(s) 514
StyI CCWWGG 1 cut(s) 221
TaaI ACNGT 1 cut(s) 172
TaqI TCGA 1 cut(s) 43
TasI AATT 2 cut(s) 37, 154
TatI WGTACW 1 cut(s) 521
TfiI GAWTC 2 cut(s) 16, 559
Tru1I TTAA 4 cut(s) 60, 72, 167, 539
Tru9I TTAA 4 cut(s) 60, 72, 167, 539
TscAI CASTG 1 cut(s) 26
TspDTI ATGAA 4 cut(s) 152, 335, 443, 474
TspGWI ACGGA 1 cut(s) 249
TspRI CASTG 1 cut(s) 26
XapI RAATTY 1 cut(s) 154
XceI RCATGY 1 cut(s) 353
XspI CTAG 1 cut(s) 583
Zsp2I ATGCAT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.