Rh2CG608900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
78452335 .. 78454325
1991 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG608900.1

Sequence Viewer

Length: 183 bp
ATGGCAAACTCCGTTAATCCCTTACTTCCATCACAAGCCAAGGAAAGACATATTTTTGGCATCTGTAGCAGAGCTGCTCAACATGCAGCTGATGAGCGTGAAGGAAAGAGAAGGTGGTCTGATGGGATTCATCAGCCTGTGGAGGCTAAAGAATGTTTGAAGATTCAGAGGTCAGCAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.75

Weight (kDa)

9.3

Isoelectric Point (pI)

77.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 160
AluBI AGCT 2 cut(s) 74, 89
AluI AGCT 2 cut(s) 74, 89
ApeKI GCWGC 2 cut(s) 74, 86
BbvI GCAGC 2 cut(s) 61, 98
BccI CCATC 2 cut(s) 37, 116
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 2 cut(s) 75, 87
BlsI GCNGC 2 cut(s) 76, 88
BmsI GCATC 1 cut(s) 69
BsaJI CCNNGG 1 cut(s) 39
Bse3DI GCAATG 1 cut(s) 183
BseDI CCNNGG 1 cut(s) 39
BseMI GCAATG 1 cut(s) 183
BseXI GCAGC 2 cut(s) 61, 98
BsrDI GCAATG 1 cut(s) 183
BssECI CCNNGG 1 cut(s) 39
BssT1I CCWWGG 1 cut(s) 39
BstMWI GCNNNNNNNGC 2 cut(s) 66, 83
BstNSI RCATGY 1 cut(s) 86
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 2 cut(s) 61, 98
CviAII CATG 1 cut(s) 83
CviJI RGCY 5 cut(s) 38, 74, 89, 136, 146
CviKI_1 RGCY 5 cut(s) 38, 74, 89, 136, 146
Eco130I CCWWGG 1 cut(s) 39
EcoT14I CCWWGG 1 cut(s) 39
ErhI CCWWGG 1 cut(s) 39
FaeI CATG 1 cut(s) 86
FaiI YATR 2 cut(s) 51, 84
FatI CATG 1 cut(s) 82
Fnu4HI GCNGC 2 cut(s) 75, 87
Fsp4HI GCNGC 2 cut(s) 75, 87
GluI GCNGC 2 cut(s) 75, 87
Hin1II CATG 1 cut(s) 86
HinfI GANTC 2 cut(s) 127, 163
Hpy188I TCNGA 2 cut(s) 121, 168
HpyAV CCTTC 2 cut(s) 95, 105
HpyCH4V TGCA 1 cut(s) 86
HpyF10VI GCNNNNNNNGC 2 cut(s) 66, 83
Hsp92II CATG 1 cut(s) 86
LpnPI CCDG 1 cut(s) 150
Lsp1109I GCAGC 2 cut(s) 61, 98
LweI GCATC 1 cut(s) 69
MboII GAAGA 1 cut(s) 172
MnlI CCTC 2 cut(s) 136, 162
MseI TTAA 1 cut(s) 15
MspA1I CMGCKG 1 cut(s) 89
MwoI GCNNNNNNNGC 2 cut(s) 66, 83
NlaIII CATG 1 cut(s) 86
NspI RCATGY 1 cut(s) 86
PfeI GAWTC 2 cut(s) 127, 163
PkrI GCNGC 2 cut(s) 76, 88
PvuII CAGCTG 1 cut(s) 89
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 2 cut(s) 75, 87
SetI ASST 4 cut(s) 76, 91, 116, 173
SfaNI GCATC 1 cut(s) 69
SfcI CTRYAG 1 cut(s) 64
SgeI CNNG 5 cut(s) 47, 52, 95, 110, 149
StyI CCWWGG 1 cut(s) 39
TfiI GAWTC 2 cut(s) 127, 163
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TseI GCWGC 2 cut(s) 74, 86
TspDTI ATGAA 1 cut(s) 119
XceI RCATGY 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.