Rroxscaffold_3G00250370

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
44174262 .. 44177499
3238 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00250370.1

Sequence Viewer

Length: 234 bp
ATGTCCATGAAGAAAGACAAAGATCAGGGATCCAAAATGAATAGAGAGTGGATTCATTCTAAAAACAAACTCAGCCAAGAATACAAGGATGGTATTCAGTCTTTCATTGGATTAAGAACTGGATTAATCAATGTCGGATGCTTTGGGAATTCTCCATTTTTTTTAACATGGTTTAAATTTCAATTGGATCGATATGTGGCTAGGAGCATGAAGGTTAATTATGTGGTATACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

9.11

Weight (kDa)

9.81

Isoelectric Point (pI)

35.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 228
AclWI GGATC 3 cut(s) 24, 37, 195
AcsI RAATTY 2 cut(s) 148, 176
AgsI TTSAA 1 cut(s) 182
AlwI GGATC 3 cut(s) 24, 37, 195
ApoI RAATTY 2 cut(s) 148, 176
AseI ATTAAT 1 cut(s) 125
BamHI GGATCC 1 cut(s) 29
BccI CCATC 1 cut(s) 83
BfaI CTAG 1 cut(s) 201
BmiI GGNNCC 1 cut(s) 31
BmsI GCATC 1 cut(s) 128
Bsa29I ATCGAT 1 cut(s) 190
Bse1I ACTGG 1 cut(s) 124
BseCI ATCGAT 1 cut(s) 190
BseGI GGATG 2 cut(s) 94, 143
BseMII CTCAG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 124
BshVI ATCGAT 1 cut(s) 190
Bsp143I GATC 3 cut(s) 22, 29, 187
BspCNI CTCAG 1 cut(s) 84
BspDI ATCGAT 1 cut(s) 190
BspLI GGNNCC 1 cut(s) 31
BspPI GGATC 3 cut(s) 24, 37, 195
BsrI ACTGG 1 cut(s) 124
BssMI GATC 3 cut(s) 22, 29, 187
BssNAI GTATAC 1 cut(s) 229
Bst1107I GTATAC 1 cut(s) 229
BstDEI CTNAG 1 cut(s) 71
BstF5I GGATG 2 cut(s) 94, 143
BstKTI GATC 3 cut(s) 25, 32, 190
BstMBI GATC 3 cut(s) 22, 29, 187
BstX2I RGATCY 1 cut(s) 29
BstYI RGATCY 1 cut(s) 29
BstZ17I GTATAC 1 cut(s) 229
Bsu15I ATCGAT 1 cut(s) 190
BsuTUI ATCGAT 1 cut(s) 190
BtsCI GGATG 2 cut(s) 94, 143
ClaI ATCGAT 1 cut(s) 190
CviAII CATG 3 cut(s) 7, 168, 208
CviJI RGCY 2 cut(s) 75, 200
CviKI_1 RGCY 2 cut(s) 75, 200
DdeI CTNAG 1 cut(s) 71
DpnI GATC 3 cut(s) 24, 31, 189
DpnII GATC 3 cut(s) 22, 29, 187
DraI TTTAAA 1 cut(s) 175
EcoRI GAATTC 1 cut(s) 148
FaeI CATG 3 cut(s) 10, 171, 211
FaiI YATR 6 cut(s) 8, 169, 195, 209, 222, 229
FatI CATG 3 cut(s) 6, 167, 207
FblI GTMKAC 1 cut(s) 228
FokI GGATG 2 cut(s) 101, 150
FspBI CTAG 1 cut(s) 201
Hin1II CATG 3 cut(s) 10, 171, 211
HinfI GANTC 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 229
Hpy188I TCNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 229
HpyAV CCTTC 1 cut(s) 205
HpyF3I CTNAG 1 cut(s) 71
Hsp92II CATG 3 cut(s) 10, 171, 211
Kzo9I GATC 3 cut(s) 22, 29, 187
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 2 cut(s) 11, 105
LweI GCATC 1 cut(s) 128
MaeI CTAG 1 cut(s) 201
MalI GATC 3 cut(s) 24, 31, 189
MboI GATC 3 cut(s) 22, 29, 187
MboII GAAGA 1 cut(s) 22
MfeI CAATTG 1 cut(s) 182
MflI RGATCY 1 cut(s) 29
MluCI AATT 4 cut(s) 148, 176, 182, 217
MmeI TCCRAC 1 cut(s) 115
MseI TTAA 5 cut(s) 113, 125, 164, 174, 216
MunI CAATTG 1 cut(s) 182
NdeII GATC 3 cut(s) 22, 29, 187
NlaIII CATG 3 cut(s) 10, 171, 211
NlaIV GGNNCC 1 cut(s) 31
PfeI GAWTC 1 cut(s) 52
PshBI ATTAAT 1 cut(s) 125
PspN4I GGNNCC 1 cut(s) 31
PsuI RGATCY 1 cut(s) 29
SaqAI TTAA 5 cut(s) 113, 125, 164, 174, 216
Sau3AI GATC 3 cut(s) 22, 29, 187
SetI ASST 1 cut(s) 216
SfaNI GCATC 1 cut(s) 128
SgeI CNNG 8 cut(s) 19, 38, 89, 97, 132, 180, 213, 220
Sse9I AATT 4 cut(s) 148, 176, 182, 217
SspMI CTAG 1 cut(s) 201
TaqI TCGA 1 cut(s) 190
TasI AATT 4 cut(s) 148, 176, 182, 217
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 5 cut(s) 113, 125, 164, 174, 216
Tru9I TTAA 5 cut(s) 113, 125, 164, 174, 216
TspDTI ATGAA 5 cut(s) 23, 44, 53, 94, 224
VspI ATTAAT 1 cut(s) 125
XapI RAATTY 2 cut(s) 148, 176
XmiI GTMKAC 1 cut(s) 228
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.