Rmu_sc0003158.1_g000011

transposon protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003158.1
Physical Location & Seq
Reverse (-)
50472 .. 50933
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003158.1_g000011.1.cds

Sequence Viewer

Length: 462 bp
atgaataggcagtggattcactgcgatcgacgtagtgaagagtacaaaaatggggtcaaatcattcattgaatttgctaaacagaatgtgaatgaggagaatgagactgtatgtccctgctctagttgtggttattcaaagttgaaaactattgatgtagttcacatccatttactgcaacatgggttgtcggtaatatttgaaacgtactttaggttaggaagtgagagtatgccttctccagttcaggagccagccactgaacccaacaatgacatatttgatatgatggatgatatgcttgataggcatgactctattgatcagcctattgaagggggtgaagacactctagagggcgatgatattgataaggttcaaagggtagatggtgataactatgataagttattacttgaagcacaaagggaattgttccccggttgcaacatgctttggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

17.66

Weight (kDa)

4.45

Isoelectric Point (pI)

61.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AfaI GTAC 2 cut(s) 44, 209
AfiI CCNNNNNNNGG 1 cut(s) 335
AgsI TTSAA 7 cut(s) 71, 138, 145, 203, 335, 380, 419
AhdI GACNNNNNGTC 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 98
AlwNI CAGNNNCTG 1 cut(s) 260
ApoI RAATTY 1 cut(s) 71
ArsI GACNNNNNNTTYG 2 cut(s) 39, 71
AsuC2I CCSGG 1 cut(s) 441
AsuHPI GGTGA 2 cut(s) 353, 404
BbsI GAAGAC 1 cut(s) 351
BccI CCATC 2 cut(s) 283, 383
BclI TGATCA 1 cut(s) 322
BcnI CCSGG 1 cut(s) 441
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 2 cut(s) 123, 353
Bme1390I CCNGG 1 cut(s) 441
BmeRI GACNNNNNGTC 1 cut(s) 111
BmiI GGNNCC 1 cut(s) 252
BmrFI CCNGG 1 cut(s) 441
BpiI GAAGAC 1 cut(s) 351
BpmI CTGGAG 1 cut(s) 225
BpuMI CCSGG 1 cut(s) 441
BsaJI CCNNGG 1 cut(s) 439
Bsc4I CCNNNNNNNGG 1 cut(s) 335
Bse1I ACTGG 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 439
BseGI GGATG 2 cut(s) 165, 298
BseLI CCNNNNNNNGG 1 cut(s) 335
BseNI ACTGG 1 cut(s) 242
BseRI GAGGAG 1 cut(s) 110
Bsh1285I CGRYCG 1 cut(s) 28
BsiEI CGRYCG 1 cut(s) 28
BsiSI CCGG 1 cut(s) 441
BslFI GGGAC 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 335
BsmAI GTCTC 1 cut(s) 98
BsmFI GGGAC 1 cut(s) 99
Bsp143I GATC 2 cut(s) 25, 322
BspLI GGNNCC 1 cut(s) 252
BsrI ACTGG 1 cut(s) 242
BssECI CCNNGG 1 cut(s) 439
BssMI GATC 2 cut(s) 25, 322
Bst4CI ACNGT 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 255
BstENI CCTNNNNNAGG 1 cut(s) 333
BstF5I GGATG 2 cut(s) 165, 298
BstKTI GATC 2 cut(s) 28, 325
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 2 cut(s) 25, 322
BstMCI CGRYCG 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 307
BstNSI RCATGY 1 cut(s) 454
BstSCI CCNGG 1 cut(s) 439
BstV2I GAAGAC 1 cut(s) 351
BtgZI GCGATG 1 cut(s) 375
BtsCI GGATG 2 cut(s) 165, 298
BtsI GCAGTG 2 cut(s) 17, 19
BtsIMutI CAGTG 3 cut(s) 17, 19, 258
Cac8I GCNNGC 1 cut(s) 255
CaiI CAGNNNCTG 1 cut(s) 260
Csp6I GTAC 2 cut(s) 43, 208
CviAII CATG 3 cut(s) 182, 311, 451
CviJI RGCY 3 cut(s) 253, 257, 328
CviKI_1 RGCY 3 cut(s) 253, 257, 328
CviQI GTAC 2 cut(s) 43, 208
DpnI GATC 2 cut(s) 27, 324
DpnII GATC 2 cut(s) 25, 322
DriI GACNNNNNGTC 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 33
Eam1105I GACNNNNNGTC 1 cut(s) 111
EarI CTCTTC 1 cut(s) 33
EcoNI CCTNNNNNAGG 1 cut(s) 333
FaeI CATG 3 cut(s) 185, 314, 454
FaiI YATR 9 cut(s) 112, 183, 233, 278, 287, 299, 312, 402, 452
FaqI GGGAC 1 cut(s) 99
FatI CATG 3 cut(s) 181, 310, 450
FbaI TGATCA 1 cut(s) 322
FokI GGATG 2 cut(s) 152, 305
FspBI CTAG 2 cut(s) 123, 353
GsuI CTGGAG 1 cut(s) 225
HapII CCGG 1 cut(s) 441
Hin1II CATG 3 cut(s) 185, 314, 454
HinfI GANTC 2 cut(s) 16, 314
HpaII CCGG 1 cut(s) 441
HphI GGTGA 2 cut(s) 353, 404
Hpy166II GTNNAC 1 cut(s) 163
Hpy188III TCNNGA 2 cut(s) 248, 353
Hpy8I GTNNAC 1 cut(s) 163
Hpy99I CGWCG 1 cut(s) 33
HpyAV CCTTC 2 cut(s) 246, 329
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 31, 206
HpyCH4V TGCA 2 cut(s) 178, 447
HpyF10VI GCNNNNNNNGC 1 cut(s) 307
HpySE526I ACGT 2 cut(s) 31, 206
Hsp92II CATG 3 cut(s) 185, 314, 454
Ksp22I TGATCA 1 cut(s) 322
Kzo9I GATC 2 cut(s) 25, 322
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 5 cut(s) 130, 233, 255, 267, 454
MaeI CTAG 2 cut(s) 123, 353
MaeII ACGT 2 cut(s) 31, 206
MalI GATC 2 cut(s) 27, 324
MboI GATC 2 cut(s) 25, 322
MboII GAAGA 2 cut(s) 50, 356
MluCI AATT 2 cut(s) 71, 431
MlyI GAGTC 1 cut(s) 308
MnlI CCTC 2 cut(s) 88, 349
MspI CCGG 1 cut(s) 441
MspR9I CCNGG 1 cut(s) 441
MwoI GCNNNNNNNGC 1 cut(s) 307
NciI CCSGG 1 cut(s) 441
NdeII GATC 2 cut(s) 25, 322
NlaIII CATG 3 cut(s) 185, 314, 454
NlaIV GGNNCC 1 cut(s) 252
NspI RCATGY 1 cut(s) 454
PfeI GAWTC 1 cut(s) 16
Ple19I CGATCG 1 cut(s) 28
PleI GAGTC 1 cut(s) 308
PpsI GAGTC 1 cut(s) 308
PspN4I GGNNCC 1 cut(s) 252
PstNI CAGNNNCTG 1 cut(s) 260
PvuI CGATCG 1 cut(s) 28
RsaI GTAC 2 cut(s) 44, 209
RsaNI GTAC 2 cut(s) 43, 208
Sau3AI GATC 2 cut(s) 25, 322
SchI GAGTC 1 cut(s) 308
ScrFI CCNGG 1 cut(s) 441
SetI ASST 4 cut(s) 34, 209, 218, 378
Sse9I AATT 2 cut(s) 71, 431
SspI AATATT 1 cut(s) 198
SspMI CTAG 2 cut(s) 123, 353
StyD4I CCNGG 1 cut(s) 439
TaaI ACNGT 1 cut(s) 109
TaiI ACGT 2 cut(s) 34, 209
TaqI TCGA 1 cut(s) 28
TasI AATT 2 cut(s) 71, 431
TatI WGTACW 1 cut(s) 42
TfiI GAWTC 1 cut(s) 16
TscAI CASTG 3 cut(s) 17, 26, 265
TspDTI ATGAA 2 cut(s) 17, 55
TspRI CASTG 3 cut(s) 17, 26, 265
XagI CCTNNNNNAGG 1 cut(s) 333
XapI RAATTY 1 cut(s) 71
XbaI TCTAGA 1 cut(s) 352
XceI RCATGY 1 cut(s) 454
XspI CTAG 2 cut(s) 123, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.