Rmu_co8441523.1_g000001

transposon protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8441523.1
Physical Location & Seq
Reverse (-)
1235 .. 1570
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8441523.1_g000001.1.cds

Sequence Viewer

Length: 336 bp
atgcagagtcaaactattcctaatagcccagttgatgcatctgaacacaatacaggtatttttgatatgatgaacgatttttttccaatgggtaatgcacatgtaacgggcgatggaaatgatataggggaggatgaggacgacgatttagatgatacatcaggaaatcaggataccgaaggggcttatgatactattggtgttcataatgaagataaagataactacgataagctactgcaagaagctgaacgagaactctaccctggttgtacagaatattcagttttaacatttgttgtggagttgattcactacgaagttgacaatctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.41

Weight (kDa)

4.05

Isoelectric Point (pI)

37.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 274
AflIII ACRYGT 1 cut(s) 100
AjnI CCWGG 1 cut(s) 265
AluBI AGCT 2 cut(s) 235, 248
AluI AGCT 2 cut(s) 235, 248
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 267
BciVI GTATCC 1 cut(s) 166
BfaI CTAG 1 cut(s) 334
BfuI GTATCC 1 cut(s) 166
Bme1390I CCNGG 1 cut(s) 267
BmrFI CCNGG 1 cut(s) 267
BmrI ACTGGG 1 cut(s) 23
BmsI GCATC 2 cut(s) 25, 47
BmuI ACTGGG 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 265
Bse1I ACTGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 267
BseDI CCNNGG 1 cut(s) 265
BseGI GGATG 1 cut(s) 139
BseNI ACTGG 1 cut(s) 29
Bsp1407I TGTACA 1 cut(s) 272
BsrGI TGTACA 1 cut(s) 272
BsrI ACTGG 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 265
Bst2UI CCWGG 1 cut(s) 267
BstAUI TGTACA 1 cut(s) 272
BstF5I GGATG 1 cut(s) 139
BstNI CCWGG 1 cut(s) 267
BstNSI RCATGY 1 cut(s) 104
BstSCI CCNGG 1 cut(s) 265
BsuI GTATCC 1 cut(s) 166
BtgZI GCGATG 1 cut(s) 126
BtsCI GGATG 1 cut(s) 139
Csp6I GTAC 1 cut(s) 273
CviAII CATG 1 cut(s) 101
CviJI RGCY 4 cut(s) 27, 185, 235, 248
CviKI_1 RGCY 4 cut(s) 27, 185, 235, 248
CviQI GTAC 1 cut(s) 273
EcoRII CCWGG 1 cut(s) 265
EcoT22I ATGCAT 1 cut(s) 40
FaeI CATG 1 cut(s) 104
FaiI YATR 5 cut(s) 68, 102, 125, 189, 207
FatI CATG 1 cut(s) 100
FokI GGATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 334
Hin1II CATG 1 cut(s) 104
HincII GTYRAC 1 cut(s) 325
HindII GTYRAC 1 cut(s) 325
HinfI GANTC 2 cut(s) 7, 310
Hpy166II GTNNAC 1 cut(s) 325
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 2 cut(s) 162, 170
Hpy8I GTNNAC 1 cut(s) 325
Hpy99I CGWCG 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 173
HpyCH4V TGCA 4 cut(s) 4, 38, 98, 241
Hsp92II CATG 1 cut(s) 104
LpnPI CCDG 6 cut(s) 39, 42, 147, 155, 252, 279
LweI GCATC 2 cut(s) 25, 47
MaeI CTAG 1 cut(s) 334
MaeIII GTNAC 1 cut(s) 103
MboII GAAGA 1 cut(s) 224
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 2 cut(s) 124, 130
Mph1103I ATGCAT 1 cut(s) 40
MseI TTAA 1 cut(s) 290
MspR9I CCNGG 1 cut(s) 267
MvaI CCWGG 1 cut(s) 267
NlaIII CATG 1 cut(s) 104
NsiI ATGCAT 1 cut(s) 40
NspI RCATGY 1 cut(s) 104
PciI ACATGT 1 cut(s) 100
PfeI GAWTC 1 cut(s) 310
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
PscI ACATGT 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 265
PspGI CCWGG 1 cut(s) 265
RsaI GTAC 1 cut(s) 274
RsaNI GTAC 1 cut(s) 273
SaqAI TTAA 1 cut(s) 290
SchI GAGTC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 267
SetI ASST 3 cut(s) 58, 237, 250
SfaNI GCATC 2 cut(s) 25, 47
SspI AATATT 1 cut(s) 281
SspMI CTAG 1 cut(s) 334
StyD4I CCNGG 1 cut(s) 265
TatI WGTACW 1 cut(s) 272
TfiI GAWTC 1 cut(s) 310
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TspDTI ATGAA 3 cut(s) 86, 194, 225
XceI RCATGY 1 cut(s) 104
XspI CTAG 1 cut(s) 334
Zsp2I ATGCAT 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.