RchiOBHm_Chr6g0258181

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
13563052 .. 13563558
507 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23151

Sequence Viewer

Length: 168 bp
ATGCCTCCTCCAAAAGATGCTTGCCAAGACAATATTCAAACGACAAGTCTGACAATAGATGCTATTCTGGAGCGTGTAGATGAAGATCACTCCAAGGATTACAGTGATCATCGTTTTGGCTCCAATCTACTATTTCATCCAGGACTTGTCACTCTTGAAGATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.2

Weight (kDa)

4.42

Isoelectric Point (pI)

48.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000561)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 38, 158
AjnI CCWGG 1 cut(s) 139
AjuI GAANNNNNNNTTGG 2 cut(s) 18, 50
ArsI GACNNNNNNTTYG 2 cut(s) 31, 63
BciT130I CCWGG 1 cut(s) 141
BclI TGATCA 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 141
BmsI GCATC 2 cut(s) 7, 49
BpmI CTGGAG 1 cut(s) 89
BsaBI GATNNNNATC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 93
Bse8I GATNNNNATC 1 cut(s) 84
BseBI CCWGG 1 cut(s) 141
BseDI CCNNGG 1 cut(s) 93
BseGI GGATG 1 cut(s) 136
BseJI GATNNNNATC 1 cut(s) 84
Bsp143I GATC 2 cut(s) 85, 106
BspLI GGNNCC 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 93
BssMI GATC 2 cut(s) 85, 106
BssT1I CCWWGG 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 141
Bst4CI ACNGT 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 22
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 2 cut(s) 88, 109
BstMBI GATC 2 cut(s) 85, 106
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BtsCI GGATG 1 cut(s) 136
BtsIMutI CAGTG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 22
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
DpnI GATC 2 cut(s) 87, 108
DpnII GATC 2 cut(s) 85, 106
Eco130I CCWWGG 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 139
EcoT14I CCWWGG 1 cut(s) 93
ErhI CCWWGG 1 cut(s) 93
FbaI TGATCA 1 cut(s) 106
FokI GGATG 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 2 cut(s) 68, 155
HpyCH4III ACNGT 1 cut(s) 104
Ksp22I TGATCA 1 cut(s) 106
Kzo9I GATC 2 cut(s) 85, 106
LmnI GCTCC 2 cut(s) 70, 125
LpnPI CCDG 3 cut(s) 53, 126, 153
LweI GCATC 2 cut(s) 7, 49
MaeIII GTNAC 1 cut(s) 148
MalI GATC 2 cut(s) 87, 108
MboI GATC 2 cut(s) 85, 106
MboII GAAGA 1 cut(s) 95
MnlI CCTC 2 cut(s) 15, 18
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
NdeII GATC 2 cut(s) 85, 106
NlaIV GGNNCC 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 148
PfoI TCCNGGA 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PspN4I GGNNCC 1 cut(s) 121
Sau3AI GATC 2 cut(s) 85, 106
ScrFI CCNGG 1 cut(s) 141
SfaNI GCATC 2 cut(s) 7, 49
SgeI CNNG 9 cut(s) 33, 38, 57, 80, 86, 106, 152, 153, 158
SspI AATATT 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 139
StyI CCWWGG 1 cut(s) 93
TaaI ACNGT 1 cut(s) 104
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
TspDTI ATGAA 2 cut(s) 96, 125
TspRI CASTG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.