Rmu_co8021096.1_g000001

Pentatricopeptide repeat-containing protein At4g16390

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8021096.1
Physical Location & Seq
Reverse (-)
2 .. 366
365 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8021096.1_g000001.1.cds

Sequence Viewer

Length: 365 bp
atgatgactatatattcctgtagtgggaaagtctcggaggcaaggagaacgttgaatgagatgatggaagctggtttccagcttaatatccttattttgatatcactaatacaattctatgggaaggccaagcgtactgatgatgttgtcgaggcattcaatcaactacaacaattgggcataactccagatgagcatttctgtggttatctcctgaatgtgatgactcaaacaccaaagggtgaactacctgagttgaatgattgcattaagcgtggtaatgagaagcttggatatgttgtaagacctctggtagggaagcaagacagtagtcaaaacttcaggaaggaagcatcagaactttt

Protein Analysis

121

Amino Acids

13.71

Weight (kDa)

5.83

Isoelectric Point (pI)

36.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 325
AfaI GTAC 1 cut(s) 136
AfiI CCNNNNNNNGG 2 cut(s) 24, 314
AgsI TTSAA 3 cut(s) 55, 160, 259
AluBI AGCT 3 cut(s) 71, 82, 289
AluI AGCT 3 cut(s) 71, 82, 289
Alw26I GTCTC 1 cut(s) 37
AoxI GGCC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 254
BccI CCATC 1 cut(s) 58
BcoDI GTCTC 1 cut(s) 37
BfmI CTRYAG 1 cut(s) 19
BoxI GACNNNNGTC 1 cut(s) 330
BpmI CTGGAG 1 cut(s) 171
Bsc4I CCNNNNNNNGG 2 cut(s) 24, 314
BseLI CCNNNNNNNGG 2 cut(s) 24, 314
BseMII CTCAG 1 cut(s) 243
BshFI GGCC 1 cut(s) 128
BslI CCNNNNNNNGG 2 cut(s) 24, 314
BsmAI GTCTC 1 cut(s) 37
BsmI GAATGC 1 cut(s) 155
BsnI GGCC 1 cut(s) 128
BspANI GGCC 1 cut(s) 128
BspCNI CTCAG 1 cut(s) 244
Bst4CI ACNGT 1 cut(s) 329
BstDEI CTNAG 1 cut(s) 252
BstENI CCTNNNNNAGG 1 cut(s) 312
BstMAI GTCTC 1 cut(s) 37
BstPAI GACNNNNGTC 1 cut(s) 330
BstSFI CTRYAG 1 cut(s) 19
BsuRI GGCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 135
CviJI RGCY 4 cut(s) 71, 82, 128, 289
CviKI_1 RGCY 4 cut(s) 71, 82, 128, 289
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 1 cut(s) 252
Eco32I GATATC 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 325
EcoNI CCTNNNNNAGG 1 cut(s) 312
EcoRV GATATC 1 cut(s) 102
FaiI YATR 5 cut(s) 11, 13, 120, 182, 297
GsuI CTGGAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 128
HindIII AAGCTT 1 cut(s) 287
HinfI GANTC 1 cut(s) 226
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 245
Hpy188I TCNGA 2 cut(s) 37, 358
Hpy188III TCNNGA 3 cut(s) 188, 214, 343
Hpy8I GTNNAC 1 cut(s) 245
HpyAV CCTTC 2 cut(s) 118, 340
HpyCH4III ACNGT 1 cut(s) 329
HpyCH4IV ACGT 1 cut(s) 50
HpyCH4V TGCA 1 cut(s) 267
HpyF3I CTNAG 1 cut(s) 252
HpySE526I ACGT 1 cut(s) 50
LpnPI CCDG 8 cut(s) 31, 57, 92, 201, 227, 264, 296, 328
MaeII ACGT 1 cut(s) 50
MfeI CAATTG 1 cut(s) 173
MluCI AATT 2 cut(s) 113, 173
MlyI GAGTC 1 cut(s) 220
MnlI CCTC 3 cut(s) 31, 145, 318
MseI TTAA 2 cut(s) 84, 270
MslI CAYNNNNRTG 1 cut(s) 201
MunI CAATTG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 155
PctI GAATGC 1 cut(s) 155
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
PshAI GACNNNNGTC 1 cut(s) 330
Psp1406I AACGTT 1 cut(s) 50
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 2 cut(s) 84, 270
SchI GAGTC 1 cut(s) 220
SetI ASST 6 cut(s) 53, 73, 84, 253, 291, 310
SfcI CTRYAG 1 cut(s) 19
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 2 cut(s) 113, 173
TaaI ACNGT 1 cut(s) 329
TaiI ACGT 1 cut(s) 53
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 113, 173
Tru1I TTAA 2 cut(s) 84, 270
Tru9I TTAA 2 cut(s) 84, 270
XagI CCTNNNNNAGG 1 cut(s) 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.