Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8127328.1

Orthogroup ID

OG0001068

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 596

Gene Structure 596 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8127328.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 337 bp

atgcaaagcattagggatctggttgattctgcaattacagatccagatgtgaagggtgggttgagatggcccctggagaagacatgttctggaaagtacaacgttgttggggcctggcatgtaagagccaaagtatataaaaatcagtcattaagatttaacgtcaggcatgccgatcgatttgatttcagaacctcaattggtgaagtttcttgggagatcagtctgaggttgaaaaagctagtctcaaagttgaaggaagagaaggttgaagttggctcggtttctgagatgctggaggaaaatatgaagttcatatatgacaacttcttaagct

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

112

Amino Acids

13.0

Weight (kDa)

9.07

Isoelectric Point (pI)

30.41

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001068)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G38430
fragaria_vesca	FvH4_6g01151 FvH4_6g01152 FvH4_6g01160
malus_domestica	MD04G1235900.v1.1 MD12G1253500.v1.1 MD12G1253600.v1.1 MD12G1253900.v1.1 MD12G1254000.v1.1 MD12G1254300.v1.1 MD12G1254400.v1.1 MD12G1254500.v1.1 MD12G1254700.v1.1 MD12G1254800.v1.1 MD12G1254900.v1.1
prunus_persica	Prupe.6G355800_v2.0.a1
pyrus_communis	pycom04g20940 pycom04g20960 pycom12g23260 pycom12g23270 pycom12g23280 pycom12g23290 pycom12g23300 pycom12g23320 pycom12g23330 pycom12g23340 pycom12g23350
rosa_chinensis	RchiOBHm_Chr3g0448691 RchiOBHm_Chr3g0448711
rosa_laevigata	RLG00000025878 RLG00000025879
rosa_multiflora	Rmu_co8127328.1_g000001 Rmu_co8209414.1_g000001 Rmu_sc0003116.1_g000032 Rmu_sc0017810.1_g000003 Rmu_sc0017810.1_g000004 Rmu_sc0027086.1_g000004
rosa_roxburghii	Rroxscaffold_3G00247840 Rroxscaffold_6G00426960 Rroxscaffold_6G00426980 Rroxscaffold_7G00204450
rosa_rugosa	Rorug02G0615400 Rorug02G0615400 Rorug02G0615500 Rorug02G0615600 Rorug02G0615700 Rorug02G0615800 Rorug02G0615900 Rorug02G0616000 Rorug02G0616000 Rorug02G0616100
rosa_samantha	Rh3AG014200 Rh3AG014300 Rh3BG014000 Rh3BG014100 Rh3CG013000 Rh3CG013100 Rh3DG014700
rosa_wichuraiana	Rw3G001050 Rw3G001060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclI	AACGTT	1 cut(s)	102
AclWI	GGATC	2 cut(s)	24, 35
AfaI	GTAC	1 cut(s)	98
AflII	CTTAAG	1 cut(s)	331
AflIII	ACRYGT	1 cut(s)	83
AgsI	TTSAA	3 cut(s)	235, 256, 272
AjnI	CCWGG	2 cut(s)	72, 113
AluBI	AGCT	2 cut(s)	241, 336
AluI	AGCT	2 cut(s)	241, 336
Alw26I	GTCTC	1 cut(s)	250
AlwI	GGATC	2 cut(s)	24, 35
AoxI	GGCC	2 cut(s)	68, 111
AspS9I	GGNCC	2 cut(s)	69, 111
AsuHPI	GGTGA	1 cut(s)	215
BbsI	GAAGAC	1 cut(s)	86
BccI	CCATC	1 cut(s)	60
BcgI	CGANNNNNNTGC	2 cut(s)	158, 192
BciT130I	CCWGG	2 cut(s)	74, 115
BcoDI	GTCTC	1 cut(s)	250
BfaI	CTAG	1 cut(s)	242
BfrI	CTTAAG	1 cut(s)	331
Bme1390I	CCNGG	2 cut(s)	74, 115
BmgT120I	GGNCC	2 cut(s)	69, 111
BmiI	GGNNCC	2 cut(s)	71, 112
BmrFI	CCNGG	2 cut(s)	74, 115
BmsI	GCATC	1 cut(s)	282
BpiI	GAAGAC	1 cut(s)	86
BpmI	CTGGAG	2 cut(s)	95, 317
Bsa29I	ATCGAT	1 cut(s)	178
BsaJI	CCNNGG	1 cut(s)	72
BseBI	CCWGG	2 cut(s)	74, 115
BseCI	ATCGAT	1 cut(s)	178
BseDI	CCNNGG	1 cut(s)	72
BseMII	CTCAG	2 cut(s)	218, 279
Bsh1285I	CGRYCG	1 cut(s)	178
BshFI	GGCC	2 cut(s)	70, 113
BshVI	ATCGAT	1 cut(s)	178
BsiEI	CGRYCG	1 cut(s)	178
BsmAI	GTCTC	1 cut(s)	250
BsnI	GGCC	2 cut(s)	70, 113
Bsp143I	GATC	4 cut(s)	16, 40, 175, 219
BspANI	GGCC	2 cut(s)	70, 113
BspCNI	CTCAG	2 cut(s)	219, 280
BspDI	ATCGAT	1 cut(s)	178
BspLI	GGNNCC	2 cut(s)	71, 112
BspPI	GGATC	2 cut(s)	24, 35
BspTI	CTTAAG	1 cut(s)	331
BssECI	CCNNGG	1 cut(s)	72
BssMI	GATC	4 cut(s)	16, 40, 175, 219
Bst2UI	CCWGG	2 cut(s)	74, 115
Bst6I	CTCTTC	1 cut(s)	255
BstAFI	CTTAAG	1 cut(s)	331
BstC8I	GCNNGC	1 cut(s)	171
BstDEI	CTNAG	2 cut(s)	227, 288
BstKTI	GATC	4 cut(s)	19, 43, 178, 222
BstMAI	GTCTC	1 cut(s)	250
BstMBI	GATC	4 cut(s)	16, 40, 175, 219
BstMCI	CGRYCG	1 cut(s)	178
BstNI	CCWGG	2 cut(s)	74, 115
BstNSI	RCATGY	3 cut(s)	87, 122, 173
BstSCI	CCNGG	2 cut(s)	72, 113
BstV2I	GAAGAC	1 cut(s)	86
BstX2I	RGATCY	2 cut(s)	16, 40
BstYI	RGATCY	2 cut(s)	16, 40
Bsu15I	ATCGAT	1 cut(s)	178
BsuRI	GGCC	2 cut(s)	70, 113
BsuTUI	ATCGAT	1 cut(s)	178
Cac8I	GCNNGC	1 cut(s)	171
Cfr13I	GGNCC	2 cut(s)	69, 111
ClaI	ATCGAT	1 cut(s)	178
Csp6I	GTAC	1 cut(s)	97
CviAII	CATG	3 cut(s)	84, 119, 170
CviJI	RGCY	6 cut(s)	70, 113, 128, 241, 279, 336
CviKI_1	RGCY	6 cut(s)	70, 113, 128, 241, 279, 336
CviQI	GTAC	1 cut(s)	97
DdeI	CTNAG	2 cut(s)	227, 288
DpnI	GATC	4 cut(s)	18, 42, 177, 221
DpnII	GATC	4 cut(s)	16, 40, 175, 219
Eam1104I	CTCTTC	1 cut(s)	255
EarI	CTCTTC	1 cut(s)	255
EcoO109I	RGGNCCY	1 cut(s)	111
EcoRII	CCWGG	2 cut(s)	72, 113
FaeI	CATG	3 cut(s)	87, 122, 173
FaiI	YATR	9 cut(s)	85, 120, 136, 138, 171, 308, 317, 319, 321
FatI	CATG	3 cut(s)	83, 118, 169
FspBI	CTAG	1 cut(s)	242
GsuI	CTGGAG	2 cut(s)	95, 317
HaeIII	GGCC	2 cut(s)	70, 113
Hin1II	CATG	3 cut(s)	87, 122, 173
HinfI	GANTC	1 cut(s)	26
HphI	GGTGA	1 cut(s)	215
Hpy188I	TCNGA	3 cut(s)	191, 228, 289
Hpy188III	TCNNGA	2 cut(s)	44, 90
HpyAV	CCTTC	3 cut(s)	46, 250, 259
HpyCH4IV	ACGT	2 cut(s)	102, 162
HpyCH4V	TGCA	2 cut(s)	4, 32
HpyF3I	CTNAG	2 cut(s)	227, 288
HpySE526I	ACGT	2 cut(s)	102, 162
Hsp92II	CATG	3 cut(s)	87, 122, 173
Kzo9I	GATC	4 cut(s)	16, 40, 175, 219
LpnPI	CCDG	9 cut(s)	5, 57, 59, 75, 86, 100, 127, 151, 281
LweI	GCATC	1 cut(s)	282
MaeI	CTAG	1 cut(s)	242
MaeII	ACGT	2 cut(s)	102, 162
MalI	GATC	4 cut(s)	18, 42, 177, 221
MboI	GATC	4 cut(s)	16, 40, 175, 219
MboII	GAAGA	2 cut(s)	91, 272
MfeI	CAATTG	1 cut(s)	198
MflI	RGATCY	2 cut(s)	16, 40
MluCI	AATT	2 cut(s)	33, 198
MnlI	CCTC	3 cut(s)	205, 222, 292
MseI	TTAA	3 cut(s)	152, 159, 332
MspCI	CTTAAG	1 cut(s)	331
MspR9I	CCNGG	2 cut(s)	74, 115
MunI	CAATTG	1 cut(s)	198
MvaI	CCWGG	2 cut(s)	74, 115
NdeII	GATC	4 cut(s)	16, 40, 175, 219
NlaIII	CATG	3 cut(s)	87, 122, 173
NlaIV	GGNNCC	2 cut(s)	71, 112
NspI	RCATGY	3 cut(s)	87, 122, 173
PaeI	GCATGC	1 cut(s)	173
PciI	ACATGT	1 cut(s)	83
PfeI	GAWTC	1 cut(s)	26
Ple19I	CGATCG	1 cut(s)	178
PscI	ACATGT	1 cut(s)	83
Psp1406I	AACGTT	1 cut(s)	102
Psp6I	CCWGG	2 cut(s)	72, 113
PspGI	CCWGG	2 cut(s)	72, 113
PspN4I	GGNNCC	2 cut(s)	71, 112
PspPI	GGNCC	2 cut(s)	69, 111
PsuI	RGATCY	2 cut(s)	16, 40
PvuI	CGATCG	1 cut(s)	178
RsaI	GTAC	1 cut(s)	98
RsaNI	GTAC	1 cut(s)	97
SaqAI	TTAA	3 cut(s)	152, 159, 332
Sau3AI	GATC	4 cut(s)	16, 40, 175, 219
Sau96I	GGNCC	2 cut(s)	69, 111
ScrFI	CCNGG	2 cut(s)	74, 115
SetI	ASST	6 cut(s)	105, 165, 197, 233, 243, 270
SfaNI	GCATC	1 cut(s)	282
SmlI	CTYRAG	1 cut(s)	331
SmoI	CTYRAG	1 cut(s)	331
SphI	GCATGC	1 cut(s)	173
Sse9I	AATT	2 cut(s)	33, 198
SspMI	CTAG	1 cut(s)	242
StyD4I	CCNGG	2 cut(s)	72, 113
TaiI	ACGT	2 cut(s)	105, 165
TaqI	TCGA	1 cut(s)	178
TasI	AATT	2 cut(s)	33, 198
TatI	WGTACW	1 cut(s)	96
TfiI	GAWTC	1 cut(s)	26
Tru1I	TTAA	3 cut(s)	152, 159, 332
Tru9I	TTAA	3 cut(s)	152, 159, 332
TspDTI	ATGAA	2 cut(s)	304, 323
Vha464I	CTTAAG	1 cut(s)	331
XceI	RCATGY	3 cut(s)	87, 122, 173
XspI	CTAG	1 cut(s)	242

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.