Rorug02G0616100

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0001068
Physical Location & Seq
Forward (+)
73397324 .. 73404627
7304 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0616100.1

Sequence Viewer

Length: 243 bp
ATGAAAGGGGTATTCCATGACACTCAGCCGTTCCCTCCACCAGAGGAAAGTGGTCCTTCAAGTTCAACACCAGACCAAGTTTCAACAATGAAAAAAAGGAACTTCCACTCAGTGAGGAAGCAGCTGTTCGCGTCAGTGCCTAACAAAAGTACAAATAGCCCCTCAAATGAGAACGACGCAACAGACATGACGGAATCAACTGAAGACACATCAAGAGGAGTTGATGCAAATAGTTGGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.83

Weight (kDa)

5.16

Isoelectric Point (pI)

56.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 131
AcuI CTGAAG 1 cut(s) 222
AdeI CACNNNGTG 1 cut(s) 112
AfaI GTAC 1 cut(s) 151
AgsI TTSAA 3 cut(s) 60, 66, 84
AluBI AGCT 1 cut(s) 124
AluI AGCT 1 cut(s) 124
ApeKI GCWGC 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 53
AvaII GGWCC 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 210
BbvI GCAGC 1 cut(s) 133
BceAI ACGGC 1 cut(s) 13
BisI GCNGC 1 cut(s) 122
BlsI GCNGC 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmsI GCATC 1 cut(s) 214
BpiI GAAGAC 1 cut(s) 210
BseMII CTCAG 2 cut(s) 38, 123
BseRI GAGGAG 1 cut(s) 231
BseXI GCAGC 1 cut(s) 133
Bsh1236I CGCG 1 cut(s) 131
BspCNI CTCAG 2 cut(s) 37, 122
BspFNI CGCG 1 cut(s) 131
BstDEI CTNAG 2 cut(s) 24, 109
BstFNI CGCG 1 cut(s) 131
BstUI CGCG 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 210
BtsIMutI CAGTG 2 cut(s) 117, 141
Cfr13I GGNCC 1 cut(s) 53
CseI GACGC 2 cut(s) 120, 185
Csp6I GTAC 1 cut(s) 150
CviAII CATG 2 cut(s) 17, 187
CviJI RGCY 3 cut(s) 28, 124, 159
CviKI_1 RGCY 3 cut(s) 28, 124, 159
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 2 cut(s) 24, 109
DraIII CACNNNGTG 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 222
FaeI CATG 2 cut(s) 20, 190
FaiI YATR 2 cut(s) 18, 188
FalI AAGNNNNNCTT 2 cut(s) 40, 72
FatI CATG 2 cut(s) 16, 186
Fnu4HI GCNGC 1 cut(s) 122
Fsp4HI GCNGC 1 cut(s) 122
GluI GCNGC 1 cut(s) 122
HgaI GACGC 2 cut(s) 120, 185
Hin1II CATG 2 cut(s) 20, 190
HinfI GANTC 1 cut(s) 194
Hpy188III TCNNGA 1 cut(s) 213
Hpy99I CGWCG 1 cut(s) 179
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 1 cut(s) 227
HpyF3I CTNAG 2 cut(s) 24, 109
Hsp92II CATG 2 cut(s) 20, 190
LpnPI CCDG 2 cut(s) 54, 84
Lsp1109I GCAGC 1 cut(s) 133
LweI GCATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 215
MnlI CCTC 5 cut(s) 37, 45, 108, 172, 209
MspA1I CMGCKG 1 cut(s) 124
MvnI CGCG 1 cut(s) 131
NlaIII CATG 2 cut(s) 20, 190
PfeI GAWTC 1 cut(s) 194
PkrI GCNGC 1 cut(s) 123
PspPI GGNCC 1 cut(s) 53
PvuII CAGCTG 1 cut(s) 124
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SatI GCNGC 1 cut(s) 122
Sau96I GGNCC 1 cut(s) 53
SetI ASST 1 cut(s) 126
SfaNI GCATC 1 cut(s) 214
SgeI CNNG 8 cut(s) 29, 53, 72, 83, 89, 142, 199, 225
SinI GGWCC 1 cut(s) 53
TatI WGTACW 1 cut(s) 149
TfiI GAWTC 1 cut(s) 194
TscAI CASTG 2 cut(s) 117, 141
TseI GCWGC 1 cut(s) 121
TspDTI ATGAA 2 cut(s) 17, 104
TspGWI ACGGA 1 cut(s) 206
TspRI CASTG 2 cut(s) 117, 141
VpaK11BI GGWCC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.