Rmu_sc0017810.1_g000003

Encoded by

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017810.1
OG0001068
Physical Location & Seq
Forward (+)
4554 .. 6160
1607 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017810.1_g000003.1.cds

Sequence Viewer

Length: 765 bp
atggcttacatcccaccacacaagcgaagctcaaacgaagctgagaggccgtttccaactccagacaagcttgctcctttgtttaagagaaatgtaaatgtaaggtcatcaaagtctaatgataattggactgggaaggtagtttgggcagaccaagccatttcgaaatggtgtgcacttggtttggatgatgacacccagtttccatcatctgttaatcttgaactcatttccttggaaaccattgagcacaaaatcggagaaaagcgtctagctttaatgaattctggtcttgctactgaaggtagtgaggtgaaatgggacctgccaaagagtccttgggtgtatatagcagagaatgtgcttgaagacctaattgcgtcttttgacaatatgaggaaggaaatggagtctccaaagttagaagaactgaagcctaatttgattgctcgagttggaaaagttctcttccataggaacccttcagttaacctggaatctctgagagaaaatttaactacaaaaatgttgaaaaattggaggagatcattttacacaaatgttcctgtttcctatacggagaagattgtaaacaaagttgtcccgaatattggagttgattttgaatcggagaaagatatatacctagtaaagttggctgattccacaacaccagattcaactctcctctgcaaatgtagtgtgaaggcagatggaaaactacaactctacaaggcaagttttctaatcatccaactatattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

254

Amino Acids

28.9

Weight (kDa)

8.28

Isoelectric Point (pI)

41.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 333
AcsI RAATTY 2 cut(s) 283, 511
AcuI CTGAAG 3 cut(s) 321, 452, 468
AfiI CCNNNNNNNGG 1 cut(s) 611
AgsI TTSAA 5 cut(s) 224, 368, 532, 626, 681
AjnI CCWGG 1 cut(s) 492
AluBI AGCT 4 cut(s) 30, 41, 70, 275
AluI AGCT 4 cut(s) 30, 41, 70, 275
Alw21I GWGCWC 2 cut(s) 178, 252
Alw26I GTCTC 1 cut(s) 417
Alw44I GTGCAC 1 cut(s) 174
Ama87I CYCGRG 1 cut(s) 450
AoxI GGCC 1 cut(s) 47
ApaLI GTGCAC 1 cut(s) 174
ApoI RAATTY 2 cut(s) 283, 511
AspS9I GGNCC 1 cut(s) 322
AsuHPI GGTGA 1 cut(s) 325
AsuII TTCGAA 1 cut(s) 164
AvaI CYCGRG 1 cut(s) 450
AvaII GGWCC 1 cut(s) 322
BaeGI GKGCMC 1 cut(s) 178
BbsI GAAGAC 1 cut(s) 375
Bbv12I GWGCWC 2 cut(s) 178, 252
BccI CCATC 2 cut(s) 214, 707
BceAI ACGGC 1 cut(s) 34
BciT130I CCWGG 1 cut(s) 494
BcoDI GTCTC 1 cut(s) 417
BfaI CTAG 2 cut(s) 272, 647
BfuAI ACCTGC 1 cut(s) 333
Bme1390I CCNGG 1 cut(s) 494
Bme18I GGWCC 1 cut(s) 322
BmeT110I CYCGRG 1 cut(s) 450
BmgT120I GGNCC 1 cut(s) 322
BmiI GGNNCC 2 cut(s) 323, 479
BmrFI CCNGG 1 cut(s) 494
BmrI ACTGGG 2 cut(s) 141, 193
BmuI ACTGGG 2 cut(s) 141, 193
BpiI GAAGAC 1 cut(s) 375
BpmI CTGGAG 1 cut(s) 45
Bpu14I TTCGAA 1 cut(s) 164
BsaJI CCNNGG 2 cut(s) 234, 338
Bsc4I CCNNNNNNNGG 1 cut(s) 611
Bse1I ACTGG 2 cut(s) 136, 199
BseBI CCWGG 1 cut(s) 494
BseDI CCNNGG 2 cut(s) 234, 338
BseGI GGATG 3 cut(s) 9, 193, 750
BseLI CCNNNNNNNGG 1 cut(s) 611
BseMII CTCAG 2 cut(s) 33, 494
BseNI ACTGG 2 cut(s) 136, 199
BseRI GAGGAG 2 cut(s) 556, 677
BseSI GKGCMC 1 cut(s) 178
BshFI GGCC 1 cut(s) 49
BsiHKAI GWGCWC 2 cut(s) 178, 252
BsiHKCI CYCGRG 1 cut(s) 450
BslFI GGGAC 2 cut(s) 335, 587
BslI CCNNNNNNNGG 1 cut(s) 611
BsmAI GTCTC 1 cut(s) 417
BsmFI GGGAC 2 cut(s) 335, 587
BsnI GGCC 1 cut(s) 49
BsoBI CYCGRG 1 cut(s) 450
Bsp119I TTCGAA 1 cut(s) 164
Bsp1286I GDGCHC 2 cut(s) 178, 252
Bsp143I GATC 1 cut(s) 545
BspANI GGCC 1 cut(s) 49
BspCNI CTCAG 2 cut(s) 34, 495
BspLI GGNNCC 2 cut(s) 323, 479
BspMI ACCTGC 1 cut(s) 333
BspT104I TTCGAA 1 cut(s) 164
BsrI ACTGG 2 cut(s) 136, 199
BssECI CCNNGG 2 cut(s) 234, 338
BssMI GATC 1 cut(s) 545
BssT1I CCWWGG 2 cut(s) 234, 338
Bst2UI CCWGG 1 cut(s) 494
Bst6I CTCTTC 1 cut(s) 473
BstBI TTCGAA 1 cut(s) 164
BstC8I GCNNGC 1 cut(s) 72
BstDEI CTNAG 2 cut(s) 42, 503
BstF5I GGATG 3 cut(s) 9, 193, 750
BstKTI GATC 1 cut(s) 548
BstMAI GTCTC 1 cut(s) 417
BstMBI GATC 1 cut(s) 545
BstMWI GCNNNNNNNGC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 494
BstSCI CCNGG 1 cut(s) 492
BstSLI GKGCMC 1 cut(s) 178
BstV2I GAAGAC 1 cut(s) 375
BsuRI GGCC 1 cut(s) 49
BtsCI GGATG 3 cut(s) 9, 193, 750
BveI ACCTGC 1 cut(s) 333
Cac8I GCNNGC 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 322
CseI GACGC 2 cut(s) 257, 369
CviJI RGCY 9 cut(s) 5, 30, 41, 49, 70, 158, 275, 436, 659
CviKI_1 RGCY 9 cut(s) 5, 30, 41, 49, 70, 158, 275, 436, 659
DdeI CTNAG 2 cut(s) 42, 503
DpnI GATC 1 cut(s) 547
DpnII GATC 1 cut(s) 545
Eam1104I CTCTTC 1 cut(s) 473
EarI CTCTTC 1 cut(s) 473
Eco130I CCWWGG 2 cut(s) 234, 338
Eco47I GGWCC 1 cut(s) 322
Eco57I CTGAAG 3 cut(s) 321, 452, 468
Eco88I CYCGRG 1 cut(s) 450
EcoO109I RGGNCCY 1 cut(s) 322
EcoRI GAATTC 1 cut(s) 283
EcoRII CCWGG 1 cut(s) 492
EcoT14I CCWWGG 2 cut(s) 234, 338
ErhI CCWWGG 2 cut(s) 234, 338
FaiI YATR 8 cut(s) 348, 350, 395, 474, 576, 641, 643, 760
FaqI GGGAC 2 cut(s) 335, 587
FokI GGATG 2 cut(s) 200, 737
FspBI CTAG 2 cut(s) 272, 647
GsuI CTGGAG 1 cut(s) 45
HaeIII GGCC 1 cut(s) 49
HgaI GACGC 2 cut(s) 257, 369
HincII GTYRAC 1 cut(s) 490
HindII GTYRAC 1 cut(s) 490
HindIII AAGCTT 1 cut(s) 68
HinfI GANTC 6 cut(s) 334, 410, 497, 626, 662, 677
HpaI GTTAAC 1 cut(s) 490
HphI GGTGA 1 cut(s) 325
Hpy166II GTNNAC 3 cut(s) 176, 490, 592
Hpy188I TCNGA 3 cut(s) 260, 504, 631
Hpy188III TCNNGA 3 cut(s) 62, 221, 604
Hpy8I GTNNAC 3 cut(s) 176, 490, 592
HpyAV CCTTC 5 cut(s) 130, 296, 394, 492, 700
HpyCH4V TGCA 2 cut(s) 176, 693
HpyF10VI GCNNNNNNNGC 1 cut(s) 155
HpyF3I CTNAG 2 cut(s) 42, 503
KspAI GTTAAC 1 cut(s) 490
Kzo9I GATC 1 cut(s) 545
LmnI GCTCC 1 cut(s) 79
LpnPI CCDG 9 cut(s) 75, 117, 212, 273, 338, 479, 506, 579, 687
MaeI CTAG 2 cut(s) 272, 647
MalI GATC 1 cut(s) 547
MboI GATC 1 cut(s) 545
MboII GAAGA 4 cut(s) 380, 437, 460, 595
MhlI GDGCHC 2 cut(s) 178, 252
MluCI AATT 6 cut(s) 124, 283, 375, 439, 511, 535
MlyI GAGTC 2 cut(s) 343, 419
MmeI TCCRAC 2 cut(s) 80, 436
MnlI CCTC 5 cut(s) 39, 304, 390, 534, 698
MseI TTAA 5 cut(s) 84, 216, 278, 489, 515
MspR9I CCNGG 1 cut(s) 494
MvaI CCWGG 1 cut(s) 494
MwoI GCNNNNNNNGC 1 cut(s) 155
NdeII GATC 1 cut(s) 545
NlaIV GGNNCC 2 cut(s) 323, 479
NspV TTCGAA 1 cut(s) 164
PaeR7I CTCGAG 1 cut(s) 450
PfeI GAWTC 4 cut(s) 497, 626, 662, 677
PleI GAGTC 2 cut(s) 342, 418
PpsI GAGTC 2 cut(s) 342, 418
PpuMI RGGWCCY 1 cut(s) 322
Psp5II RGGWCCY 1 cut(s) 322
Psp6I CCWGG 1 cut(s) 492
PspGI CCWGG 1 cut(s) 492
PspN4I GGNNCC 2 cut(s) 323, 479
PspPI GGNCC 1 cut(s) 322
PspPPI RGGWCCY 1 cut(s) 322
PspXI VCTCGAGB 1 cut(s) 450
SaqAI TTAA 5 cut(s) 84, 216, 278, 489, 515
Sau3AI GATC 1 cut(s) 545
Sau96I GGNCC 1 cut(s) 322
SchI GAGTC 2 cut(s) 343, 419
ScrFI CCNGG 1 cut(s) 494
SduI GDGCHC 2 cut(s) 178, 252
Sfr274I CTCGAG 1 cut(s) 450
SfuI TTCGAA 1 cut(s) 164
SinI GGWCC 1 cut(s) 322
SlaI CTCGAG 1 cut(s) 450
SmlI CTYRAG 1 cut(s) 450
SmoI CTYRAG 1 cut(s) 450
Sse9I AATT 6 cut(s) 124, 283, 375, 439, 511, 535
SspI AATATT 1 cut(s) 610
SspMI CTAG 2 cut(s) 272, 647
StyD4I CCNGG 1 cut(s) 492
StyI CCWWGG 2 cut(s) 234, 338
TaqI TCGA 2 cut(s) 164, 451
TasI AATT 6 cut(s) 124, 283, 375, 439, 511, 535
TfiI GAWTC 4 cut(s) 497, 626, 662, 677
Tru1I TTAA 5 cut(s) 84, 216, 278, 489, 515
Tru9I TTAA 5 cut(s) 84, 216, 278, 489, 515
TspDTI ATGAA 1 cut(s) 296
TspGWI ACGGA 1 cut(s) 593
VneI GTGCAC 1 cut(s) 174
VpaK11BI GGWCC 1 cut(s) 322
XapI RAATTY 2 cut(s) 283, 511
XcmI CCANNNNNNNNNTGG 1 cut(s) 336
XhoI CTCGAG 1 cut(s) 450
XspI CTAG 2 cut(s) 272, 647
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.