Rmu_co8320635.1_g000001

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8320635.1
Physical Location & Seq
Forward (+)
16 .. 702
687 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8320635.1_g000001.1.cds

Sequence Viewer

Length: 687 bp
atgagtgctgtcgagagccaaaagaagaaggcgaagatgtatttagagagataccttcattattttgaacgctgggacaacaatggaaaatcaaagcaaaaggctcttgaggattttgataaggtgaagaatgtgcacatacatgaacttggaaagatacagggaaatacaaaagagcatgaatacaatttcatcatagaggcctggcaacagataataatatgcaggcaagtactgcaatggacctatgcttatggctactacatgagtgatgatgagcctcgcaagagtcagctattcgagatcttgcaaggccatgccgagttcagcctcgagaggcttcacaagtgtgccgagagcgaactgcagcagtttcttgtctgtggtgataacaatgaccacttgctgaaaatttacggggattttagaaagagactcataaacctgacaaaggtgactggaacttattttgagaagctggctagtgcactggaggagggccttcctgagacgtgcccctatgatgaggctagttggacctgcgaccagtgtacttatatcaatgtggggactgccatcacctgtgacgtgtgtaatatggaacgtaatggttggtgttgcgacctctgtacttatcggaatccagcctctgccatgagctatgagatgtgttcttatgctgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

228

Amino Acids

26.74

Weight (kDa)

5.45

Isoelectric Point (pI)

48.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 548
AcsI RAATTY 1 cut(s) 411
AfaI GTAC 3 cut(s) 234, 553, 631
AfiI CCNNNNNNNGG 1 cut(s) 451
AflIII ACRYGT 1 cut(s) 588
AgsI TTSAA 1 cut(s) 68
AjiI CACGTC 2 cut(s) 513, 589
AjnI CCWGG 1 cut(s) 203
AleI CACNNNNGTG 1 cut(s) 348
AluBI AGCT 3 cut(s) 295, 478, 660
AluI AGCT 3 cut(s) 295, 478, 660
Alw21I GWGCWC 2 cut(s) 138, 490
Alw26I GTCTC 2 cut(s) 427, 503
Alw44I GTGCAC 2 cut(s) 134, 486
AlwNI CAGNNNCTG 1 cut(s) 650
Ama87I CYCGRG 1 cut(s) 332
AoxI GGCC 3 cut(s) 201, 313, 499
ApaLI GTGCAC 2 cut(s) 134, 486
ApeKI GCWGC 1 cut(s) 367
ApoI RAATTY 1 cut(s) 411
AspS9I GGNCC 3 cut(s) 243, 499, 537
AsuHPI GGTGA 4 cut(s) 136, 398, 466, 571
AvaI CYCGRG 1 cut(s) 332
AvaII GGWCC 2 cut(s) 243, 537
BaeGI GKGCMC 3 cut(s) 138, 490, 518
Bbv12I GWGCWC 2 cut(s) 138, 490
BbvI GCAGC 1 cut(s) 379
BccI CCATC 1 cut(s) 584
BciT130I CCWGG 1 cut(s) 205
BcoDI GTCTC 2 cut(s) 427, 503
BfaI CTAG 2 cut(s) 483, 531
BfmI CTRYAG 1 cut(s) 365
BfuAI ACCTGC 1 cut(s) 548
BglII AGATCT 1 cut(s) 303
BisI GCNGC 1 cut(s) 368
BlsI GCNGC 1 cut(s) 369
BmcAI AGTACT 1 cut(s) 234
Bme1390I CCNGG 1 cut(s) 205
Bme18I GGWCC 2 cut(s) 243, 537
BmeT110I CYCGRG 1 cut(s) 332
BmgBI CACGTC 2 cut(s) 513, 589
BmgT120I GGNCC 3 cut(s) 243, 499, 537
BmrFI CCNGG 1 cut(s) 205
BpmI CTGGAG 1 cut(s) 512
BpuEI CTTGAG 1 cut(s) 128
Bsc4I CCNNNNNNNGG 1 cut(s) 451
Bse1I ACTGG 3 cut(s) 463, 495, 547
Bse3DI GCAATG 1 cut(s) 245
BseBI CCWGG 1 cut(s) 205
BseLI CCNNNNNNNGG 1 cut(s) 451
BseMI GCAATG 1 cut(s) 245
BseMII CTCAG 2 cut(s) 498, 672
BseNI ACTGG 3 cut(s) 463, 495, 547
BseRI GAGGAG 1 cut(s) 509
BseSI GKGCMC 3 cut(s) 138, 490, 518
BseXI GCAGC 1 cut(s) 379
BseYI CCCAGC 1 cut(s) 72
BshFI GGCC 3 cut(s) 203, 315, 501
BsiHKAI GWGCWC 2 cut(s) 138, 490
BsiHKCI CYCGRG 1 cut(s) 332
BslFI GGGAC 2 cut(s) 89, 583
BslI CCNNNNNNNGG 1 cut(s) 451
BsmAI GTCTC 2 cut(s) 427, 503
BsmBI CGTCTC 1 cut(s) 503
BsmFI GGGAC 2 cut(s) 89, 583
BsnI GGCC 3 cut(s) 203, 315, 501
BsoBI CYCGRG 1 cut(s) 332
Bsp1286I GDGCHC 3 cut(s) 138, 490, 518
Bsp143I GATC 1 cut(s) 303
BspANI GGCC 3 cut(s) 203, 315, 501
BspCNI CTCAG 2 cut(s) 499, 673
BspMAI CTGCAG 1 cut(s) 369
BspMI ACCTGC 1 cut(s) 548
BsrDI GCAATG 1 cut(s) 245
BsrI ACTGG 3 cut(s) 463, 495, 547
BssMI GATC 1 cut(s) 303
Bst2UI CCWGG 1 cut(s) 205
BstAPI GCANNNNNTGC 1 cut(s) 235
BstC8I GCNNGC 2 cut(s) 227, 480
BstDEI CTNAG 2 cut(s) 507, 681
BstENI CCTNNNNNAGG 1 cut(s) 449
BstKTI GATC 1 cut(s) 306
BstMAI GTCTC 2 cut(s) 427, 503
BstMBI GATC 1 cut(s) 303
BstMWI GCNNNNNNNGC 1 cut(s) 235
BstNI CCWGG 1 cut(s) 205
BstSCI CCNGG 1 cut(s) 203
BstSFI CTRYAG 1 cut(s) 365
BstSLI GKGCMC 3 cut(s) 138, 490, 518
BstV1I GCAGC 1 cut(s) 379
BstX2I RGATCY 1 cut(s) 303
BstYI RGATCY 1 cut(s) 303
BsuRI GGCC 3 cut(s) 203, 315, 501
BtrI CACGTC 2 cut(s) 513, 589
BtsIMutI CAGTG 2 cut(s) 488, 554
BveI ACCTGC 1 cut(s) 548
Cac8I GCNNGC 2 cut(s) 227, 480
CaiI CAGNNNCTG 1 cut(s) 650
Cfr13I GGNCC 3 cut(s) 243, 499, 537
Csp6I GTAC 3 cut(s) 233, 552, 630
CviAII CATG 5 cut(s) 143, 179, 265, 317, 655
CviQI GTAC 3 cut(s) 233, 552, 630
DdeI CTNAG 2 cut(s) 507, 681
DpnI GATC 1 cut(s) 305
DpnII GATC 1 cut(s) 303
Eco147I AGGCCT 1 cut(s) 203
Eco47I GGWCC 2 cut(s) 243, 537
Eco88I CYCGRG 1 cut(s) 332
EcoNI CCTNNNNNAGG 1 cut(s) 449
EcoO109I RGGNCCY 1 cut(s) 499
EcoRII CCWGG 1 cut(s) 203
Esp3I CGTCTC 1 cut(s) 503
FaeI CATG 5 cut(s) 146, 182, 268, 320, 658
FaqI GGGAC 2 cut(s) 89, 583
FatI CATG 5 cut(s) 142, 178, 264, 316, 654
Fnu4HI GCNGC 1 cut(s) 368
Fsp4HI GCNGC 1 cut(s) 368
FspBI CTAG 2 cut(s) 483, 531
GluI GCNGC 1 cut(s) 368
GsaI CCCAGC 1 cut(s) 76
GsuI CTGGAG 1 cut(s) 512
HaeIII GGCC 3 cut(s) 203, 315, 501
Hin1II CATG 5 cut(s) 146, 182, 268, 320, 658
HinfI GANTC 3 cut(s) 289, 435, 640
HphI GGTGA 4 cut(s) 136, 398, 466, 571
Hpy166II GTNNAC 3 cut(s) 136, 488, 552
Hpy188I TCNGA 1 cut(s) 639
Hpy188III TCNNGA 5 cut(s) 13, 107, 301, 334, 506
Hpy8I GTNNAC 3 cut(s) 136, 488, 552
HpyAV CCTTC 3 cut(s) 22, 65, 512
HpyCH4IV ACGT 3 cut(s) 512, 588, 604
HpyCH4V TGCA 6 cut(s) 136, 225, 238, 310, 367, 488
HpyF10VI GCNNNNNNNGC 1 cut(s) 235
HpyF3I CTNAG 2 cut(s) 507, 681
HpySE526I ACGT 3 cut(s) 512, 588, 604
Hsp92II CATG 5 cut(s) 146, 182, 268, 320, 658
Kzo9I GATC 1 cut(s) 303
Lsp1109I GCAGC 1 cut(s) 379
MaeI CTAG 2 cut(s) 483, 531
MaeII ACGT 3 cut(s) 512, 588, 604
MaeIII GTNAC 2 cut(s) 454, 584
MalI GATC 1 cut(s) 305
MboI GATC 1 cut(s) 303
MboII GAAGA 3 cut(s) 37, 46, 139
MflI RGATCY 1 cut(s) 303
MhlI GDGCHC 3 cut(s) 138, 490, 518
MluCI AATT 2 cut(s) 187, 411
MlyI GAGTC 2 cut(s) 298, 429
MmeI TCCRAC 1 cut(s) 515
MslI CAYNNNNRTG 2 cut(s) 141, 348
MspR9I CCNGG 1 cut(s) 205
MvaI CCWGG 1 cut(s) 205
MwoI GCNNNNNNNGC 1 cut(s) 235
NdeII GATC 1 cut(s) 303
NlaIII CATG 5 cut(s) 146, 182, 268, 320, 658
NmeAIII GCCGAG 2 cut(s) 346, 379
NmuCI GTSAC 2 cut(s) 454, 584
OliI CACNNNNGTG 1 cut(s) 348
PaeR7I CTCGAG 1 cut(s) 332
PceI AGGCCT 1 cut(s) 203
PfeI GAWTC 1 cut(s) 640
PkrI GCNGC 1 cut(s) 369
PleI GAGTC 2 cut(s) 297, 429
PpsI GAGTC 2 cut(s) 297, 429
Psp6I CCWGG 1 cut(s) 203
PspFI CCCAGC 1 cut(s) 72
PspGI CCWGG 1 cut(s) 203
PspPI GGNCC 3 cut(s) 243, 499, 537
PstI CTGCAG 1 cut(s) 369
PstNI CAGNNNCTG 1 cut(s) 650
PsuI RGATCY 1 cut(s) 303
RsaI GTAC 3 cut(s) 234, 553, 631
RsaNI GTAC 3 cut(s) 233, 552, 630
RseI CAYNNNNRTG 2 cut(s) 141, 348
SatI GCNGC 1 cut(s) 368
Sau3AI GATC 1 cut(s) 303
Sau96I GGNCC 3 cut(s) 243, 499, 537
ScaI AGTACT 1 cut(s) 234
SchI GAGTC 2 cut(s) 298, 429
ScrFI CCNGG 1 cut(s) 205
SduI GDGCHC 3 cut(s) 138, 490, 518
SfcI CTRYAG 1 cut(s) 365
Sfr274I CTCGAG 1 cut(s) 332
SinI GGWCC 2 cut(s) 243, 537
SlaI CTCGAG 1 cut(s) 332
SmiMI CAYNNNNRTG 2 cut(s) 141, 348
SmlI CTYRAG 2 cut(s) 107, 332
SmoI CTYRAG 2 cut(s) 107, 332
Sse9I AATT 2 cut(s) 187, 411
SseBI AGGCCT 1 cut(s) 203
SspMI CTAG 2 cut(s) 483, 531
StuI AGGCCT 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 203
TaiI ACGT 3 cut(s) 515, 591, 607
TaqI TCGA 3 cut(s) 12, 300, 333
TasI AATT 2 cut(s) 187, 411
TatI WGTACW 3 cut(s) 232, 551, 629
TfiI GAWTC 1 cut(s) 640
TscAI CASTG 2 cut(s) 495, 554
TseFI GTSAC 2 cut(s) 454, 584
TseI GCWGC 1 cut(s) 367
Tsp45I GTSAC 2 cut(s) 454, 584
TspDTI ATGAA 4 cut(s) 47, 159, 181, 195
TspRI CASTG 2 cut(s) 495, 554
VneI GTGCAC 2 cut(s) 134, 486
VpaK11BI GGWCC 2 cut(s) 243, 537
XagI CCTNNNNNAGG 1 cut(s) 449
XapI RAATTY 1 cut(s) 411
XhoI CTCGAG 1 cut(s) 332
XspI CTAG 2 cut(s) 483, 531
ZrmI AGTACT 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.