Rh6AG407100

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
60428913 .. 60429137
225 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG407100.1

Sequence Viewer

Length: 225 bp
ATGGAGAACGAGGACGACTACAGAACCGCAGATAGTGGCGATGAAGAATCACTGAGCTACAGCGCGGGCGACGATGACTATCTTCCAGAAGATGAACAAGTCGATGACTTTGGTGAGGGTCGATGTCCACAGGAAAATTATATTCTTCTAAAACAAGAAGAAATTGCCAAACTTCAGCAGGATTGTATTTCAGAAGTGTCGGTCGATGTCCATATCCAAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.45

Weight (kDa)

4.05

Isoelectric Point (pI)

60.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 65
AciI CCGC 2 cut(s) 27, 65
AcuI CTGAAG 1 cut(s) 158
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AspLEI GCGC 1 cut(s) 65
AsuHPI GGTGA 1 cut(s) 125
BfmI CTRYAG 2 cut(s) 19, 58
BsaBI GATNNNNATC 1 cut(s) 78
Bse8I GATNNNNATC 1 cut(s) 78
BseJI GATNNNNATC 1 cut(s) 78
BseMII CTCAG 1 cut(s) 44
Bsh1236I CGCG 1 cut(s) 65
Bsh1285I CGRYCG 1 cut(s) 204
BsiEI CGRYCG 1 cut(s) 204
BspACI CCGC 2 cut(s) 27, 65
BspCNI CTCAG 1 cut(s) 45
BspFNI CGCG 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 67
BstDEI CTNAG 1 cut(s) 53
BstFNI CGCG 1 cut(s) 65
BstHHI GCGC 1 cut(s) 65
BstMCI CGRYCG 1 cut(s) 204
BstSFI CTRYAG 2 cut(s) 19, 58
BstUI CGCG 1 cut(s) 65
BtgZI GCGATG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 50
Cac8I GCNNGC 1 cut(s) 67
CfoI GCGC 1 cut(s) 65
CviJI RGCY 1 cut(s) 57
CviKI_1 RGCY 1 cut(s) 57
DdeI CTNAG 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 158
FaiI YATR 2 cut(s) 141, 213
FauI CCCGC 1 cut(s) 58
GlaI GCGC 1 cut(s) 64
HhaI GCGC 1 cut(s) 65
Hin6I GCGC 1 cut(s) 63
HinP1I GCGC 1 cut(s) 63
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 125
Hpy166II GTNNAC 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 193, 224
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 128
Hpy99I CGWCG 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 53
HspAI GCGC 1 cut(s) 63
LpnPI CCDG 3 cut(s) 99, 116, 164
MboII GAAGA 5 cut(s) 56, 74, 101, 137, 170
MluCI AATT 2 cut(s) 136, 162
MnlI CCTC 2 cut(s) 4, 109
MvnI CGCG 1 cut(s) 65
PfeI GAWTC 1 cut(s) 47
SetI ASST 1 cut(s) 59
SfcI CTRYAG 2 cut(s) 19, 58
SgeI CNNG 8 cut(s) 22, 76, 78, 98, 110, 143, 167, 191
Sse9I AATT 2 cut(s) 136, 162
SsiI CCGC 2 cut(s) 27, 65
TaqI TCGA 3 cut(s) 102, 121, 204
TaqII GACCGA 1 cut(s) 190
TasI AATT 2 cut(s) 136, 162
TfiI GAWTC 1 cut(s) 47
TscAI CASTG 1 cut(s) 57
TspDTI ATGAA 2 cut(s) 57, 108
TspRI CASTG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.