Rh3DG202700

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
18465002 .. 18465280
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG202700.1

Sequence Viewer

Length: 279 bp
ATGCACTATGAGAGCGAAGAAGACTACACAACCGTATATAGTGGTGATGAAGATGCAGGGATCTATAGCGCATCCGATGACGATCTTGATCTTCCAGAAGATGACAAAGTCAATGGTTCTGGTGAGATTAATTATACTTTCATGAAAGAAGAAGAAATTGCCAAGCTTCAGAAAGATTATATTACAGAAGTGTCTACGGTCCTTACCATATCAAAATCCGATGCATGCTTACTGCTCCTTTACTTTAATTGGAGGGACGAGGAACTGAAAGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.61

Weight (kDa)

4.05

Isoelectric Point (pI)

55.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
UBA_ARI1 PF21235 56 - 89 1.4e-08 E3 ubiquitin-protein ligase ARIH1, UBA-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 194
AclWI GGATC 1 cut(s) 68
AcuI CTGAAG 1 cut(s) 152
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AlwI GGATC 1 cut(s) 68
AseI ATTAAT 1 cut(s) 129
AspLEI GCGC 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 199
AsuHPI GGTGA 2 cut(s) 56, 134
AvaII GGWCC 1 cut(s) 199
BbsI GAAGAC 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 64
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 1 cut(s) 199
BmsI GCATC 3 cut(s) 43, 80, 211
BpiI GAAGAC 1 cut(s) 27
BsaBI GATNNNNATC 2 cut(s) 81, 87
Bse8I GATNNNNATC 2 cut(s) 81, 87
BseGI GGATG 1 cut(s) 71
BseJI GATNNNNATC 2 cut(s) 81, 87
BslFI GGGAC 1 cut(s) 269
BsmFI GGGAC 1 cut(s) 269
Bsp143I GATC 3 cut(s) 60, 82, 88
BspHI TCATGA 1 cut(s) 141
BspPI GGATC 1 cut(s) 68
BssMI GATC 3 cut(s) 60, 82, 88
Bst4CI ACNGT 2 cut(s) 34, 199
BstC8I GCNNGC 1 cut(s) 226
BstF5I GGATG 1 cut(s) 71
BstHHI GCGC 1 cut(s) 71
BstKTI GATC 3 cut(s) 63, 85, 91
BstMBI GATC 3 cut(s) 60, 82, 88
BstNSI RCATGY 1 cut(s) 228
BstSFI CTRYAG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 27
BstX2I RGATCY 1 cut(s) 60
BstYI RGATCY 1 cut(s) 60
BtsCI GGATG 1 cut(s) 71
Cac8I GCNNGC 1 cut(s) 226
CciI TCATGA 1 cut(s) 141
CfoI GCGC 1 cut(s) 71
Cfr13I GGNCC 1 cut(s) 199
CviAII CATG 2 cut(s) 142, 225
CviJI RGCY 1 cut(s) 166
CviKI_1 RGCY 1 cut(s) 166
DpnI GATC 3 cut(s) 62, 84, 90
DpnII GATC 3 cut(s) 60, 82, 88
Eco47I GGWCC 1 cut(s) 199
Eco57I CTGAAG 1 cut(s) 152
EcoT22I ATGCAT 1 cut(s) 226
FaeI CATG 2 cut(s) 145, 228
FaiI YATR 9 cut(s) 9, 37, 39, 66, 135, 143, 180, 209, 226
FaqI GGGAC 1 cut(s) 269
FatI CATG 2 cut(s) 141, 224
FblI GTMKAC 1 cut(s) 194
FokI GGATG 1 cut(s) 58
GlaI GCGC 1 cut(s) 70
HhaI GCGC 1 cut(s) 71
Hin1II CATG 2 cut(s) 145, 228
Hin6I GCGC 1 cut(s) 69
HinP1I GCGC 1 cut(s) 69
HindIII AAGCTT 1 cut(s) 164
HphI GGTGA 2 cut(s) 56, 134
Hpy166II GTNNAC 1 cut(s) 195
Hpy188I TCNGA 3 cut(s) 76, 171, 220
Hpy188III TCNNGA 3 cut(s) 86, 95, 142
Hpy8I GTNNAC 1 cut(s) 195
HpyCH4III ACNGT 2 cut(s) 34, 199
HpyCH4V TGCA 3 cut(s) 4, 56, 224
Hsp92II CATG 2 cut(s) 145, 228
HspAI GCGC 1 cut(s) 69
Kzo9I GATC 3 cut(s) 60, 82, 88
LmnI GCTCC 1 cut(s) 240
LpnPI CCDG 3 cut(s) 42, 105, 108
LweI GCATC 3 cut(s) 43, 80, 211
MalI GATC 3 cut(s) 62, 84, 90
MboI GATC 3 cut(s) 60, 82, 88
MboII GAAGA 7 cut(s) 29, 32, 62, 83, 110, 161, 164
MflI RGATCY 1 cut(s) 60
MluCI AATT 3 cut(s) 130, 156, 247
MnlI CCTC 2 cut(s) 246, 253
Mph1103I ATGCAT 1 cut(s) 226
MseI TTAA 2 cut(s) 129, 246
NdeII GATC 3 cut(s) 60, 82, 88
NlaIII CATG 2 cut(s) 145, 228
NsiI ATGCAT 1 cut(s) 226
NspI RCATGY 1 cut(s) 228
PaeI GCATGC 1 cut(s) 228
PagI TCATGA 1 cut(s) 141
PflFI GACNNNGTC 1 cut(s) 107
PshBI ATTAAT 1 cut(s) 129
PspPI GGNCC 1 cut(s) 199
PsuI RGATCY 1 cut(s) 60
PsyI GACNNNGTC 1 cut(s) 107
SaqAI TTAA 2 cut(s) 129, 246
Sau3AI GATC 3 cut(s) 60, 82, 88
Sau96I GGNCC 1 cut(s) 199
SetI ASST 1 cut(s) 168
SfaNI GCATC 3 cut(s) 43, 80, 211
SfcI CTRYAG 1 cut(s) 64
SgeI CNNG 8 cut(s) 69, 98, 107, 132, 154, 175, 237, 271
SinI GGWCC 1 cut(s) 199
SphI GCATGC 1 cut(s) 228
Sse9I AATT 3 cut(s) 130, 156, 247
TaaI ACNGT 2 cut(s) 34, 199
TasI AATT 3 cut(s) 130, 156, 247
Tru1I TTAA 2 cut(s) 129, 246
Tru9I TTAA 2 cut(s) 129, 246
TspDTI ATGAA 3 cut(s) 63, 130, 158
Tth111I GACNNNGTC 1 cut(s) 107
VpaK11BI GGWCC 1 cut(s) 199
VspI ATTAAT 1 cut(s) 129
XceI RCATGY 1 cut(s) 228
XmiI GTMKAC 1 cut(s) 194
Zsp2I ATGCAT 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.