Rmu_co8369783.1_g000001

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8369783.1
Physical Location & Seq
Forward (+)
1 .. 387
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8369783.1_g000001.1.cds

Sequence Viewer

Length: 255 bp
gattctgcaactgatggggtgatccagaagatcatcagccaagaattcaaagatcgaactgtcgttacaatagctcacagaatccacacagttatagacagtgatctcgttttggtccttagcgatggaaggattgcagaatacgacacgccagccaagctactagagagagaagagtccttattttccaaactcataaaggagtactcaatgagatcccagagcttcaacagctttccaaatctacataactaa

Protein Analysis

84

Amino Acids

9.58

Weight (kDa)

5.5

Isoelectric Point (pI)

37.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 16, 210
AcsI RAATTY 1 cut(s) 44
AfaI GTAC 1 cut(s) 206
AgsI TTSAA 2 cut(s) 49, 229
AluBI AGCT 4 cut(s) 74, 160, 225, 234
AluI AGCT 4 cut(s) 74, 160, 225, 234
AlwI GGATC 2 cut(s) 16, 210
ApoI RAATTY 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 115
BccI CCATC 2 cut(s) 8, 119
BfaI CTAG 1 cut(s) 164
BmcAI AGTACT 1 cut(s) 206
Bme18I GGWCC 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 115
Bpu10I CCTNAGC 1 cut(s) 119
Bsp143I GATC 5 cut(s) 21, 30, 52, 103, 215
BspPI GGATC 2 cut(s) 16, 210
BssMI GATC 5 cut(s) 21, 30, 52, 103, 215
Bst4CI ACNGT 3 cut(s) 61, 91, 101
Bst6I CTCTTC 1 cut(s) 168
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 5 cut(s) 24, 33, 55, 106, 218
BstMBI GATC 5 cut(s) 21, 30, 52, 103, 215
BstMWI GCNNNNNNNGC 2 cut(s) 157, 231
BstX2I RGATCY 1 cut(s) 215
BstYI RGATCY 1 cut(s) 215
BtgZI GCGATG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 106
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 115
Csp6I GTAC 1 cut(s) 205
CviJI RGCY 6 cut(s) 39, 74, 155, 160, 225, 234
CviKI_1 RGCY 6 cut(s) 39, 74, 155, 160, 225, 234
CviQI GTAC 1 cut(s) 205
DdeI CTNAG 1 cut(s) 119
DpnI GATC 5 cut(s) 23, 32, 54, 105, 217
DpnII GATC 5 cut(s) 21, 30, 52, 103, 215
Eam1104I CTCTTC 1 cut(s) 168
EarI CTCTTC 1 cut(s) 168
Eco47I GGWCC 1 cut(s) 115
EcoRI GAATTC 1 cut(s) 44
FaiI YATR 3 cut(s) 95, 197, 249
FspBI CTAG 1 cut(s) 164
HinfI GANTC 3 cut(s) 2, 81, 176
HphI GGTGA 1 cut(s) 31
Hpy188III TCNNGA 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 123
HpyCH4III ACNGT 3 cut(s) 61, 91, 101
HpyCH4V TGCA 2 cut(s) 8, 137
HpyF10VI GCNNNNNNNGC 2 cut(s) 157, 231
HpyF3I CTNAG 1 cut(s) 119
Kzo9I GATC 5 cut(s) 21, 30, 52, 103, 215
LpnPI CCDG 3 cut(s) 38, 165, 233
MaeI CTAG 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 64
MalI GATC 5 cut(s) 23, 32, 54, 105, 217
MboI GATC 5 cut(s) 21, 30, 52, 103, 215
MboII GAAGA 2 cut(s) 40, 185
MflI RGATCY 1 cut(s) 215
MluCI AATT 1 cut(s) 44
MlyI GAGTC 1 cut(s) 185
MwoI GCNNNNNNNGC 2 cut(s) 157, 231
NdeII GATC 5 cut(s) 21, 30, 52, 103, 215
PfeI GAWTC 2 cut(s) 2, 81
PleI GAGTC 1 cut(s) 184
PpsI GAGTC 1 cut(s) 184
PspPI GGNCC 1 cut(s) 115
PsrI GAACNNNNNNTAC 2 cut(s) 49, 81
PsuI RGATCY 1 cut(s) 215
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
Sau3AI GATC 5 cut(s) 21, 30, 52, 103, 215
Sau96I GGNCC 1 cut(s) 115
ScaI AGTACT 1 cut(s) 206
SchI GAGTC 1 cut(s) 185
SetI ASST 4 cut(s) 76, 162, 227, 236
SgeI CNNG 8 cut(s) 37, 53, 119, 160, 164, 169, 176, 232
SinI GGWCC 1 cut(s) 115
Sse9I AATT 1 cut(s) 44
SspMI CTAG 1 cut(s) 164
TaaI ACNGT 3 cut(s) 61, 91, 101
TaqI TCGA 1 cut(s) 55
TasI AATT 1 cut(s) 44
TatI WGTACW 1 cut(s) 204
TfiI GAWTC 2 cut(s) 2, 81
TscAI CASTG 1 cut(s) 106
TspRI CASTG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 115
XapI RAATTY 1 cut(s) 44
XspI CTAG 1 cut(s) 164
ZrmI AGTACT 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.