Rmu_sc0002445.1_g000001

ABC transporter C family member 10-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002445.1
OG0000900
Physical Location & Seq
Forward (+)
1 .. 1646
1646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002445.1_g000001.1.cds

Sequence Viewer

Length: 866 bp
ggatgcttcggtggcagcaggctggaactcagggctgcaggaagggagcagcaggggctgctgtgcaaggttgcaagcacacgggcgctcgggctgcagcgaaggctcggctagctcgggctaggggttgctttgtaagatataggccaaattctcctttggttcttcgtgggataaattgcatcattgaaggaggctacaaaattggaattgttggccggactggaagtggaaagacaactcttatcagcattttgtttcgtgtggtagagcctacaggaggaaaggtcattgtagatggctatgacatttgcactattggccttcatgatttaagatcacgttttgggattatccctcaagatccgacattgtttggcgggtctgtgagattcaacctcgatcccttagctgagcatactgatcatgaaatatgggaggttcttgagaaatgtcagctacgagaggtcattggagaggaagaagggggcctagattctttagtcgtgcaagatggaacaaactggagcatgggacagcgacaactattctgcttggggcgtgctttattgaagaaaagccgaatactagtgcttgatgaagccacagcatcaatggacaatgcaacagactctattctccagaaaactataagaacagaatttgcagactgcactgtaataacagtggctcataggatacccacaatgatggactgcactaaggtgctcgctcttagtgatggtaaagtagtagagtatgatgagccaatgaagctgatgaacaatgagggatcactattcgggcagcttgtcaaggaatactggtctcgttctgccaatgctagcatgcagtcagaagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko01523 ko01524 ko02010 ko04976 map01523 map01524 map02010 map04976
Pfam Domains
Protein Families
ABC_membrane ABC_tran

Protein Analysis

287

Amino Acids

31.43

Weight (kDa)

8.05

Isoelectric Point (pI)

32.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 380
AclWI GGATC 3 cut(s) 358, 397, 801
AcoI YGGCCR 1 cut(s) 216
AcsI RAATTY 2 cut(s) 150, 661
AfiI CCNNNNNNNGG 1 cut(s) 280
AgsI TTSAA 3 cut(s) 190, 396, 573
AhlI ACTAGT 1 cut(s) 588
AleI CACNNNNGTG 1 cut(s) 724
AluBI AGCT 5 cut(s) 115, 412, 459, 777, 810
AluI AGCT 5 cut(s) 115, 412, 459, 777, 810
Alw21I GWGCWC 1 cut(s) 731
Alw26I GTCTC 1 cut(s) 833
AlwI GGATC 3 cut(s) 358, 397, 801
AlwNI CAGNNNCTG 1 cut(s) 58
Ama87I CYCGRG 2 cut(s) 89, 116
AoxI GGCC 4 cut(s) 145, 216, 321, 489
ApeKI GCWGC 7 cut(s) 15, 35, 49, 58, 94, 97, 807
ApoI RAATTY 2 cut(s) 150, 661
AspLEI GCGC 1 cut(s) 88
AspS9I GGNCC 1 cut(s) 489
AsuNHI GCTAGC 2 cut(s) 111, 844
AvaI CYCGRG 2 cut(s) 89, 116
Bbv12I GWGCWC 1 cut(s) 731
BbvI GCAGC 7 cut(s) 22, 27, 45, 61, 81, 109, 819
BccI CCATC 4 cut(s) 292, 508, 705, 736
BciVI GTATCC 1 cut(s) 692
BclI TGATCA 1 cut(s) 423
BcoDI GTCTC 1 cut(s) 833
BcuI ACTAGT 1 cut(s) 588
BfaI CTAG 5 cut(s) 112, 122, 493, 589, 845
BfmI CTRYAG 3 cut(s) 36, 95, 275
BfoI RGCGCY 1 cut(s) 89
BfuI GTATCC 1 cut(s) 692
BisI GCNGC 7 cut(s) 16, 36, 50, 59, 95, 98, 808
BlpI GCTNAGC 1 cut(s) 413
BlsI GCNGC 7 cut(s) 17, 37, 51, 60, 96, 99, 809
BmeT110I CYCGRG 2 cut(s) 89, 116
BmgT120I GGNCC 1 cut(s) 489
BmiI GGNNCC 1 cut(s) 490
BmsI GCATC 2 cut(s) 191, 619
BmtI GCTAGC 2 cut(s) 115, 848
BpmI CTGGAG 2 cut(s) 546, 625
Bpu10I CCTNAGC 1 cut(s) 408
Bpu1102I GCTNAGC 1 cut(s) 413
BpuEI CTTGAG 2 cut(s) 344, 466
BsaI GGTCTC 1 cut(s) 833
BsaXI ACNNNNNCTCC 2 cut(s) 272, 302
Bsc4I CCNNNNNNNGG 1 cut(s) 280
Bse1I ACTGG 3 cut(s) 228, 529, 829
BseGI GGATG 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 280
BseMII CTCAG 2 cut(s) 43, 404
BseNI ACTGG 3 cut(s) 228, 529, 829
BseXI GCAGC 7 cut(s) 22, 27, 45, 61, 81, 109, 819
BsgI GTGCAG 2 cut(s) 657, 702
BshFI GGCC 4 cut(s) 147, 218, 323, 491
BsiHKAI GWGCWC 1 cut(s) 731
BsiHKCI CYCGRG 2 cut(s) 89, 116
BsiSI CCGG 1 cut(s) 219
BslFI GGGAC 1 cut(s) 548
BslI CCNNNNNNNGG 1 cut(s) 280
BsmAI GTCTC 1 cut(s) 833
BsmFI GGGAC 1 cut(s) 548
BsnI GGCC 4 cut(s) 147, 218, 323, 491
Bso31I GGTCTC 1 cut(s) 833
BsoBI CYCGRG 2 cut(s) 89, 116
Bsp1286I GDGCHC 1 cut(s) 731
Bsp143I GATC 5 cut(s) 337, 363, 402, 423, 793
Bsp1720I GCTNAGC 1 cut(s) 413
BspACI CCGC 1 cut(s) 380
BspANI GGCC 4 cut(s) 147, 218, 323, 491
BspCNI CTCAG 2 cut(s) 42, 405
BspHI TCATGA 2 cut(s) 327, 426
BspLI GGNNCC 1 cut(s) 490
BspMAI CTGCAG 2 cut(s) 40, 99
BspOI GCTAGC 2 cut(s) 115, 848
BspPI GGATC 3 cut(s) 358, 397, 801
BspTNI GGTCTC 1 cut(s) 833
BsrI ACTGG 3 cut(s) 228, 529, 829
BssMI GATC 5 cut(s) 337, 363, 402, 423, 793
Bst4CI ACNGT 2 cut(s) 678, 687
BstAPI GCANNNNNTGC 1 cut(s) 58
BstC8I GCNNGC 7 cut(s) 20, 76, 113, 563, 731, 846, 850
BstDEI CTNAG 5 cut(s) 29, 408, 413, 722, 736
BstENI CCTNNNNNAGG 1 cut(s) 278
BstF5I GGATG 1 cut(s) 8
BstH2I RGCGCY 1 cut(s) 89
BstHHI GCGC 1 cut(s) 88
BstKTI GATC 5 cut(s) 340, 366, 405, 426, 796
BstMAI GTCTC 1 cut(s) 833
BstMBI GATC 5 cut(s) 337, 363, 402, 423, 793
BstMWI GCNNNNNNNGC 8 cut(s) 12, 55, 58, 94, 103, 112, 320, 774
BstNSI RCATGY 1 cut(s) 852
BstSFI CTRYAG 3 cut(s) 36, 95, 275
BstV1I GCAGC 7 cut(s) 22, 27, 45, 61, 81, 109, 819
BstX2I RGATCY 1 cut(s) 363
BstXI CCANNNNNNTGG 1 cut(s) 711
BstYI RGATCY 1 cut(s) 363
BsuI GTATCC 1 cut(s) 692
BsuRI GGCC 4 cut(s) 147, 218, 323, 491
BtsCI GGATG 1 cut(s) 8
BtsIMutI CAGTG 2 cut(s) 674, 692
Cac8I GCNNGC 7 cut(s) 20, 76, 113, 563, 731, 846, 850
CaiI CAGNNNCTG 1 cut(s) 58
CciI TCATGA 2 cut(s) 327, 426
CfoI GCGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 489
CviAII CATG 4 cut(s) 328, 427, 531, 849
DdeI CTNAG 5 cut(s) 29, 408, 413, 722, 736
DpnI GATC 5 cut(s) 339, 365, 404, 425, 795
DpnII GATC 5 cut(s) 337, 363, 402, 423, 793
EaeI YGGCCR 1 cut(s) 216
Eco31I GGTCTC 1 cut(s) 833
Eco88I CYCGRG 2 cut(s) 89, 116
EcoNI CCTNNNNNAGG 1 cut(s) 278
EcoO109I RGGNCCY 1 cut(s) 489
FaeI CATG 4 cut(s) 331, 430, 534, 852
FaqI GGGAC 1 cut(s) 548
FatI CATG 4 cut(s) 327, 426, 530, 848
FauI CCCGC 1 cut(s) 373
FbaI TGATCA 1 cut(s) 423
Fnu4HI GCNGC 7 cut(s) 16, 36, 50, 59, 95, 98, 808
FokI GGATG 1 cut(s) 15
Fsp4HI GCNGC 7 cut(s) 16, 36, 50, 59, 95, 98, 808
FspBI CTAG 5 cut(s) 112, 122, 493, 589, 845
GlaI GCGC 1 cut(s) 87
GluI GCNGC 7 cut(s) 16, 36, 50, 59, 95, 98, 808
GsuI CTGGAG 2 cut(s) 546, 625
HaeII RGCGCY 1 cut(s) 89
HaeIII GGCC 4 cut(s) 147, 218, 323, 491
HapII CCGG 1 cut(s) 219
HhaI GCGC 1 cut(s) 88
Hin1II CATG 4 cut(s) 331, 430, 534, 852
Hin6I GCGC 1 cut(s) 86
HinP1I GCGC 1 cut(s) 86
HinfI GANTC 3 cut(s) 392, 496, 631
HpaII CCGG 1 cut(s) 219
Hpy188I TCNGA 2 cut(s) 368, 858
Hpy188III TCNNGA 5 cut(s) 328, 361, 427, 445, 642
HpyAV CCTTC 5 cut(s) 36, 96, 184, 334, 478
HpyCH4III ACNGT 2 cut(s) 678, 687
HpyCH4IV ACGT 1 cut(s) 342
HpyF10VI GCNNNNNNNGC 8 cut(s) 12, 55, 58, 94, 103, 112, 320, 774
HpyF3I CTNAG 5 cut(s) 29, 408, 413, 722, 736
HpySE526I ACGT 1 cut(s) 342
Hsp92II CATG 4 cut(s) 331, 430, 534, 852
HspAI GCGC 1 cut(s) 86
Ksp22I TGATCA 1 cut(s) 423
Kzo9I GATC 5 cut(s) 337, 363, 402, 423, 793
LmnI GCTCC 2 cut(s) 46, 527
Lsp1109I GCAGC 7 cut(s) 22, 27, 45, 61, 81, 109, 819
LweI GCATC 2 cut(s) 191, 619
MaeI CTAG 5 cut(s) 112, 122, 493, 589, 845
MaeII ACGT 1 cut(s) 342
MalI GATC 5 cut(s) 339, 365, 404, 425, 795
MboI GATC 5 cut(s) 337, 363, 402, 423, 793
MboII GAAGA 3 cut(s) 157, 493, 585
MflI RGATCY 1 cut(s) 363
MhlI GDGCHC 1 cut(s) 731
MluCI AATT 5 cut(s) 150, 177, 203, 209, 661
MlyI GAGTC 1 cut(s) 625
MmeI TCCRAC 1 cut(s) 391
MnlI CCTC 8 cut(s) 187, 274, 368, 409, 432, 459, 471, 783
MseI TTAA 1 cut(s) 334
MslI CAYNNNNRTG 2 cut(s) 709, 724
MspI CCGG 1 cut(s) 219
MwoI GCNNNNNNNGC 8 cut(s) 12, 55, 58, 94, 103, 112, 320, 774
NdeII GATC 5 cut(s) 337, 363, 402, 423, 793
NheI GCTAGC 2 cut(s) 111, 844
NlaIII CATG 4 cut(s) 331, 430, 534, 852
NlaIV GGNNCC 1 cut(s) 490
NmeAIII GCCGAG 1 cut(s) 87
NspI RCATGY 1 cut(s) 852
OliI CACNNNNGTG 1 cut(s) 724
PaeI GCATGC 1 cut(s) 852
PagI TCATGA 2 cut(s) 327, 426
PfeI GAWTC 2 cut(s) 392, 496
PkrI GCNGC 7 cut(s) 17, 37, 51, 60, 96, 99, 809
PleI GAGTC 1 cut(s) 625
PpsI GAGTC 1 cut(s) 625
PspN4I GGNNCC 1 cut(s) 490
PspPI GGNCC 1 cut(s) 489
PstI CTGCAG 2 cut(s) 40, 99
PstNI CAGNNNCTG 1 cut(s) 58
PsuI RGATCY 1 cut(s) 363
RseI CAYNNNNRTG 2 cut(s) 709, 724
SaqAI TTAA 1 cut(s) 334
SatI GCNGC 7 cut(s) 16, 36, 50, 59, 95, 98, 808
Sau3AI GATC 5 cut(s) 337, 363, 402, 423, 793
Sau96I GGNCC 1 cut(s) 489
SchI GAGTC 1 cut(s) 625
SduI GDGCHC 1 cut(s) 731
SfaNI GCATC 2 cut(s) 191, 619
SfcI CTRYAG 3 cut(s) 36, 95, 275
SmiMI CAYNNNNRTG 2 cut(s) 709, 724
SmlI CTYRAG 2 cut(s) 359, 445
SmoI CTYRAG 2 cut(s) 359, 445
SpeI ACTAGT 1 cut(s) 588
SphI GCATGC 1 cut(s) 852
Sse9I AATT 5 cut(s) 150, 177, 203, 209, 661
SsiI CCGC 1 cut(s) 380
SspMI CTAG 5 cut(s) 112, 122, 493, 589, 845
TaaI ACNGT 2 cut(s) 678, 687
TaiI ACGT 1 cut(s) 345
TaqI TCGA 1 cut(s) 401
TasI AATT 5 cut(s) 150, 177, 203, 209, 661
TfiI GAWTC 2 cut(s) 392, 496
Tru1I TTAA 1 cut(s) 334
Tru9I TTAA 1 cut(s) 334
TscAI CASTG 2 cut(s) 681, 692
TseI GCWGC 7 cut(s) 15, 35, 49, 58, 94, 97, 807
TspDTI ATGAA 5 cut(s) 316, 443, 614, 787, 796
TspRI CASTG 2 cut(s) 681, 692
XagI CCTNNNNNAGG 1 cut(s) 278
XapI RAATTY 2 cut(s) 150, 661
XceI RCATGY 1 cut(s) 852
XcmI CCANNNNNNNNNTGG 1 cut(s) 612
XspI CTAG 5 cut(s) 112, 122, 493, 589, 845
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.