Rmu_sc0037845.1_g000001

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0037845.1
Physical Location & Seq
Forward (+)
1 .. 646
646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0037845.1_g000001.1.cds

Sequence Viewer

Length: 320 bp
aaggaacagtgagaggaaacctcgacccactggagcaatactctgacagtgatgtctgggaggctctagataaatgtcagctaggtgatctagtgcgtgcaaaggaggagaagttggatgcatcagtggtcgaaaatggagaaaattggagtgcgggccaaagacagttggtttgccttggaagagcattgctcaagaaaagcagaattctggtattggatgaagcaaccgcatcagtcgattctgcaactgatggggtgatccagaagatcatcagccaagaattcaaagatcgaactgtcgttacaatagctcacaga

Protein Analysis

106

Amino Acids

11.68

Weight (kDa)

4.95

Isoelectric Point (pI)

14.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 52
AciI CCGC 2 cut(s) 154, 230
AclWI GGATC 1 cut(s) 255
AcsI RAATTY 2 cut(s) 206, 283
AgsI TTSAA 1 cut(s) 288
AluBI AGCT 2 cut(s) 81, 313
AluI AGCT 2 cut(s) 81, 313
AlwI GGATC 1 cut(s) 255
AoxI GGCC 1 cut(s) 156
ApoI RAATTY 2 cut(s) 206, 283
ArsI GACNNNNNNTTYG 2 cut(s) 155, 187
AspS9I GGNCC 1 cut(s) 156
AsuHPI GGTGA 2 cut(s) 97, 270
BccI CCATC 1 cut(s) 247
BfaI CTAG 3 cut(s) 67, 82, 91
BmgT120I GGNCC 1 cut(s) 156
BmsI GCATC 3 cut(s) 108, 130, 241
BplI GAGNNNNNCTC 5 cut(s) 37, 25, 57, 176, 208
BpmI CTGGAG 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 178
BsaJI CCNNGG 1 cut(s) 177
BsaXI ACNNNNNCTCC 2 cut(s) 97, 127
Bse1I ACTGG 1 cut(s) 35
Bse3DI GCAATG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 177
BseGI GGATG 2 cut(s) 123, 225
BseMI GCAATG 1 cut(s) 187
BseNI ACTGG 1 cut(s) 35
BseRI GAGGAG 1 cut(s) 121
BshFI GGCC 1 cut(s) 158
BsnI GGCC 1 cut(s) 158
Bsp143I GATC 4 cut(s) 87, 260, 269, 291
BspACI CCGC 2 cut(s) 154, 230
BspANI GGCC 1 cut(s) 158
BspPI GGATC 1 cut(s) 255
BspQI GCTCTTC 1 cut(s) 177
BsrDI GCAATG 1 cut(s) 187
BsrI ACTGG 1 cut(s) 35
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 4 cut(s) 87, 260, 269, 291
BssT1I CCWWGG 1 cut(s) 177
Bst4CI ACNGT 4 cut(s) 9, 49, 167, 300
Bst6I CTCTTC 1 cut(s) 177
BstC8I GCNNGC 2 cut(s) 98, 156
BstF5I GGATG 2 cut(s) 123, 225
BstKTI GATC 4 cut(s) 90, 263, 272, 294
BstMBI GATC 4 cut(s) 87, 260, 269, 291
BsuRI GGCC 1 cut(s) 158
BtsCI GGATG 2 cut(s) 123, 225
BtsIMutI CAGTG 4 cut(s) 14, 28, 54, 131
Cac8I GCNNGC 2 cut(s) 98, 156
Cfr13I GGNCC 1 cut(s) 156
CviJI RGCY 5 cut(s) 64, 81, 158, 278, 313
CviKI_1 RGCY 5 cut(s) 64, 81, 158, 278, 313
DpnI GATC 4 cut(s) 89, 262, 271, 293
DpnII GATC 4 cut(s) 87, 260, 269, 291
DrdI GACNNNNNNGTC 1 cut(s) 52
DseDI GACNNNNNNGTC 1 cut(s) 52
Eam1104I CTCTTC 1 cut(s) 177
EarI CTCTTC 1 cut(s) 177
Eco130I CCWWGG 1 cut(s) 177
EcoRI GAATTC 2 cut(s) 206, 283
EcoT14I CCWWGG 1 cut(s) 177
EcoT22I ATGCAT 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 177
FauI CCCGC 1 cut(s) 147
FokI GGATG 2 cut(s) 130, 232
FspBI CTAG 3 cut(s) 67, 82, 91
GsuI CTGGAG 1 cut(s) 52
HaeIII GGCC 1 cut(s) 158
HinfI GANTC 1 cut(s) 241
HphI GGTGA 2 cut(s) 97, 270
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 3 cut(s) 67, 195, 264
HpyCH4III ACNGT 4 cut(s) 9, 49, 167, 300
HpyCH4V TGCA 3 cut(s) 100, 121, 247
Kzo9I GATC 4 cut(s) 87, 260, 269, 291
LguI GCTCTTC 1 cut(s) 177
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 4 cut(s) 16, 42, 196, 277
LweI GCATC 3 cut(s) 108, 130, 241
MaeI CTAG 3 cut(s) 67, 82, 91
MaeIII GTNAC 1 cut(s) 303
MalI GATC 4 cut(s) 89, 262, 271, 293
MboI GATC 4 cut(s) 87, 260, 269, 291
MboII GAAGA 2 cut(s) 194, 279
MluCI AATT 3 cut(s) 144, 206, 283
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 4 cut(s) 7, 31, 54, 99
Mph1103I ATGCAT 1 cut(s) 123
NdeII GATC 4 cut(s) 87, 260, 269, 291
NsiI ATGCAT 1 cut(s) 123
PciSI GCTCTTC 1 cut(s) 177
PfeI GAWTC 1 cut(s) 241
PspPI GGNCC 1 cut(s) 156
PsrI GAACNNNNNNTAC 2 cut(s) 288, 320
SapI GCTCTTC 1 cut(s) 177
Sau3AI GATC 4 cut(s) 87, 260, 269, 291
Sau96I GGNCC 1 cut(s) 156
SetI ASST 4 cut(s) 23, 83, 87, 315
SfaNI GCATC 3 cut(s) 108, 130, 241
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
Sse9I AATT 3 cut(s) 144, 206, 283
SsiI CCGC 2 cut(s) 154, 230
SspMI CTAG 3 cut(s) 67, 82, 91
StyI CCWWGG 1 cut(s) 177
TaaI ACNGT 4 cut(s) 9, 49, 167, 300
TaqI TCGA 4 cut(s) 23, 131, 239, 294
TasI AATT 3 cut(s) 144, 206, 283
TfiI GAWTC 1 cut(s) 241
TscAI CASTG 4 cut(s) 14, 35, 54, 131
TspDTI ATGAA 1 cut(s) 236
TspRI CASTG 4 cut(s) 14, 35, 54, 131
XapI RAATTY 2 cut(s) 206, 283
XbaI TCTAGA 1 cut(s) 66
XspI CTAG 3 cut(s) 67, 82, 91
Zsp2I ATGCAT 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.