Rmu_co8462601.1_g000001

Wall-associated receptor kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8462601.1
OG0001114
Physical Location & Seq
Forward (+)
1 .. 908
908 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8462601.1_g000001.1.cds

Sequence Viewer

Length: 848 bp
gtcttggctcttgtttctcgattcttttgtttgtgatatctggggtttatttgagtgtgaagaatctaaggtttattaaagtcaaaaccaatttcttcaagaaaaatggagggatattgctagagcagcatattgcttcacatggagatgaaatgacaacaatatttacagctgagcagctagaaatggctactaactgttaccaaagaattttacgcgataaagtagtggagggccaaggcgagagttttataaatgagattatcgctcttgcccaaatgagtcatgagaatttggtgaagttcattggctgctgtttagagactgatgctcctattttggtttatgaacttgcctctaatggaacccttttcgactgcattaatcacaccaatgggaaagttacattgccttggaatatcctcctaaagatagggtcagaatctgcagctgctcttgcttatattcattcttctgcaggaattcactccaaacacatcatccatggcaatgtcaagtcttccaacgtattgttaactgataatttcacggccaaagtctcaggtttttggccttcgaggttagtccctgctaatgaatctcagatgggcacattgcttctaaggacactaggttatatggacccagggtatctttgcacaggtcaactgacagatgagagtgatgtttatagcttcggagtcgttttggtagagatcttaacccgggaaaagcctatttcatttgacagaccagaaagtcaaagaatcattgcctctcattttgtttcatccattgaattaaaagatggtttctttcatgttgttgatccactagttttaaactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EGF EGF_CA GUB_WAK_bind Pkinase Pkinase_Tyr WAK

Protein Analysis

281

Amino Acids

31.09

Weight (kDa)

5.92

Isoelectric Point (pI)

32.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 253
AasI GACNNNNNNGTC 1 cut(s) 758
AccII CGCG 1 cut(s) 218
AclWI GGATC 1 cut(s) 823
AcoI YGGCCR 1 cut(s) 551
AcsI RAATTY 3 cut(s) 209, 291, 482
AgsI TTSAA 2 cut(s) 99, 799
AhlI ACTAGT 1 cut(s) 834
AjnI CCWGG 1 cut(s) 645
AluBI AGCT 4 cut(s) 172, 180, 451, 695
AluI AGCT 4 cut(s) 172, 180, 451, 695
Alw26I GTCTC 2 cut(s) 316, 564
AlwI GGATC 1 cut(s) 823
AlwNI CAGNNNCTG 1 cut(s) 445
Ama87I CYCGRG 1 cut(s) 725
AoxI GGCC 3 cut(s) 234, 551, 571
ApeKI GCWGC 5 cut(s) 126, 177, 311, 448, 451
ApoI RAATTY 3 cut(s) 209, 291, 482
AseI ATTAAT 1 cut(s) 383
AspS9I GGNCC 2 cut(s) 234, 642
AsuC2I CCSGG 2 cut(s) 726, 727
AsuHPI GGTGA 1 cut(s) 309
AvaI CYCGRG 1 cut(s) 725
AvaII GGWCC 1 cut(s) 642
BaeGI GKGCMC 1 cut(s) 613
BbsI GAAGAC 1 cut(s) 512
BbvI GCAGC 5 cut(s) 138, 189, 298, 438, 460
BccI CCATC 2 cut(s) 600, 802
BceAI ACGGC 1 cut(s) 566
BciT130I CCWGG 1 cut(s) 647
BcnI CCSGG 2 cut(s) 726, 727
BcoDI GTCTC 2 cut(s) 316, 564
BcuI ACTAGT 1 cut(s) 834
BfaI CTAG 5 cut(s) 121, 181, 631, 835, 846
BfmI CTRYAG 2 cut(s) 446, 476
BglII AGATCT 1 cut(s) 716
BisI GCNGC 5 cut(s) 127, 178, 312, 449, 452
BlpI GCTNAGC 1 cut(s) 173
BlsI GCNGC 5 cut(s) 128, 179, 313, 450, 453
Bme1390I CCNGG 3 cut(s) 647, 726, 727
Bme18I GGWCC 1 cut(s) 642
BmeT110I CYCGRG 1 cut(s) 725
BmgT120I GGNCC 2 cut(s) 234, 642
BmiI GGNNCC 2 cut(s) 366, 644
BmrFI CCNGG 3 cut(s) 647, 726, 727
BmsI GCATC 1 cut(s) 318
BpiI GAAGAC 1 cut(s) 512
Bpu1102I GCTNAGC 1 cut(s) 173
BpuMI CCSGG 2 cut(s) 726, 727
BsaJI CCNNGG 6 cut(s) 237, 412, 504, 645, 646, 725
BsaXI ACNNNNNCTCC 2 cut(s) 315, 345
Bse3DI GCAATG 4 cut(s) 406, 516, 613, 770
BseBI CCWGG 1 cut(s) 647
BseDI CCNNGG 6 cut(s) 237, 412, 504, 645, 646, 725
BseGI GGATG 2 cut(s) 500, 790
BseMI GCAATG 4 cut(s) 406, 516, 613, 770
BseMII CTCAG 3 cut(s) 164, 575, 616
BseSI GKGCMC 1 cut(s) 613
BseXI GCAGC 5 cut(s) 138, 189, 298, 438, 460
Bsh1236I CGCG 1 cut(s) 218
BshFI GGCC 3 cut(s) 236, 553, 573
BsiHKCI CYCGRG 1 cut(s) 725
BsiSI CCGG 1 cut(s) 726
BslFI GGGAC 1 cut(s) 571
BsmAI GTCTC 2 cut(s) 316, 564
BsmFI GGGAC 1 cut(s) 571
BsnI GGCC 3 cut(s) 236, 553, 573
BsoBI CYCGRG 1 cut(s) 725
Bsp1286I GDGCHC 1 cut(s) 613
Bsp143I GATC 2 cut(s) 716, 828
Bsp1720I GCTNAGC 1 cut(s) 173
Bsp19I CCATGG 1 cut(s) 504
BspANI GGCC 3 cut(s) 236, 553, 573
BspCNI CTCAG 3 cut(s) 165, 574, 615
BspFNI CGCG 1 cut(s) 218
BspHI TCATGA 1 cut(s) 285
BspLI GGNNCC 2 cut(s) 366, 644
BspMAI CTGCAG 2 cut(s) 450, 480
BspPI GGATC 1 cut(s) 823
BsrDI GCAATG 4 cut(s) 406, 516, 613, 770
BssECI CCNNGG 6 cut(s) 237, 412, 504, 645, 646, 725
BssMI GATC 2 cut(s) 716, 828
BssT1I CCWWGG 3 cut(s) 237, 412, 504
Bst2UI CCWGG 1 cut(s) 647
Bst4CI ACNGT 1 cut(s) 199
BstDEI CTNAG 5 cut(s) 67, 173, 561, 602, 622
BstDSI CCRYGG 1 cut(s) 504
BstF5I GGATG 2 cut(s) 500, 790
BstFNI CGCG 1 cut(s) 218
BstKTI GATC 2 cut(s) 719, 831
BstMAI GTCTC 2 cut(s) 316, 564
BstMBI GATC 2 cut(s) 716, 828
BstMWI GCNNNNNNNGC 2 cut(s) 126, 457
BstNI CCWGG 1 cut(s) 647
BstSCI CCNGG 3 cut(s) 645, 724, 725
BstSFI CTRYAG 2 cut(s) 446, 476
BstSLI GKGCMC 1 cut(s) 613
BstUI CGCG 1 cut(s) 218
BstV1I GCAGC 5 cut(s) 138, 189, 298, 438, 460
BstV2I GAAGAC 1 cut(s) 512
BstX2I RGATCY 1 cut(s) 716
BstYI RGATCY 1 cut(s) 716
BsuRI GGCC 3 cut(s) 236, 553, 573
BtgI CCRYGG 1 cut(s) 504
BtsCI GGATG 2 cut(s) 500, 790
CaiI CAGNNNCTG 1 cut(s) 445
CciI TCATGA 1 cut(s) 285
Cfr13I GGNCC 2 cut(s) 234, 642
Cfr9I CCCGGG 1 cut(s) 725
CviAII CATG 4 cut(s) 142, 286, 505, 820
DdeI CTNAG 5 cut(s) 67, 173, 561, 602, 622
DpnI GATC 2 cut(s) 718, 830
DpnII GATC 2 cut(s) 716, 828
DraI TTTAAA 1 cut(s) 842
DrdI GACNNNNNNGTC 1 cut(s) 758
DseDI GACNNNNNNGTC 1 cut(s) 758
EaeI YGGCCR 1 cut(s) 551
Eco130I CCWWGG 3 cut(s) 237, 412, 504
Eco32I GATATC 1 cut(s) 38
Eco47I GGWCC 1 cut(s) 642
Eco88I CYCGRG 1 cut(s) 725
EcoRI GAATTC 1 cut(s) 482
EcoRII CCWGG 1 cut(s) 645
EcoRV GATATC 1 cut(s) 38
EcoT14I CCWWGG 3 cut(s) 237, 412, 504
ErhI CCWWGG 3 cut(s) 237, 412, 504
FaeI CATG 4 cut(s) 145, 289, 508, 823
FaqI GGGAC 1 cut(s) 571
FatI CATG 4 cut(s) 141, 285, 504, 819
Fnu4HI GCNGC 5 cut(s) 127, 178, 312, 449, 452
FokI GGATG 2 cut(s) 487, 777
Fsp4HI GCNGC 5 cut(s) 127, 178, 312, 449, 452
FspBI CTAG 5 cut(s) 121, 181, 631, 835, 846
GluI GCNGC 5 cut(s) 127, 178, 312, 449, 452
HaeIII GGCC 3 cut(s) 236, 553, 573
HapII CCGG 1 cut(s) 726
Hin1II CATG 4 cut(s) 145, 289, 508, 823
HincII GTYRAC 2 cut(s) 536, 667
HindII GTYRAC 2 cut(s) 536, 667
HinfI GANTC 7 cut(s) 21, 63, 282, 442, 598, 701, 767
HpaI GTTAAC 1 cut(s) 536
HpaII CCGG 1 cut(s) 726
HphI GGTGA 1 cut(s) 309
Hpy166II GTNNAC 2 cut(s) 536, 667
Hpy188I TCNGA 3 cut(s) 441, 605, 700
Hpy188III TCNNGA 3 cut(s) 18, 99, 286
Hpy8I GTNNAC 2 cut(s) 536, 667
HpyAV CCTTC 1 cut(s) 584
HpyCH4III ACNGT 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 527
HpyCH4V TGCA 4 cut(s) 380, 448, 478, 659
HpyF10VI GCNNNNNNNGC 2 cut(s) 126, 457
HpyF3I CTNAG 5 cut(s) 67, 173, 561, 602, 622
HpySE526I ACGT 1 cut(s) 527
Hsp92II CATG 4 cut(s) 145, 289, 508, 823
KspAI GTTAAC 1 cut(s) 536
Kzo9I GATC 2 cut(s) 716, 828
LmnI GCTCC 1 cut(s) 336
LpnPI CCDG 9 cut(s) 26, 464, 548, 602, 632, 647, 659, 739, 767
Lsp1109I GCAGC 5 cut(s) 138, 189, 298, 438, 460
LweI GCATC 1 cut(s) 318
MaeI CTAG 5 cut(s) 121, 181, 631, 835, 846
MaeII ACGT 1 cut(s) 527
MaeIII GTNAC 2 cut(s) 199, 402
MalI GATC 2 cut(s) 718, 830
MboI GATC 2 cut(s) 716, 828
MboII GAAGA 4 cut(s) 72, 87, 464, 512
MflI RGATCY 1 cut(s) 716
MhlI GDGCHC 1 cut(s) 613
MluCI AATT 6 cut(s) 90, 209, 291, 482, 543, 799
MlyI GAGTC 2 cut(s) 291, 710
MmeI TCCRAC 1 cut(s) 548
MnlI CCTC 6 cut(s) 103, 225, 366, 433, 572, 786
MseI TTAA 6 cut(s) 77, 383, 535, 721, 802, 841
MslI CAYNNNNRTG 3 cut(s) 146, 392, 509
MspA1I CMGCKG 2 cut(s) 172, 451
MspI CCGG 1 cut(s) 726
MspR9I CCNGG 3 cut(s) 647, 726, 727
MvaI CCWGG 1 cut(s) 647
MvnI CGCG 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 126, 457
NciI CCSGG 2 cut(s) 726, 727
NcoI CCATGG 1 cut(s) 504
NdeII GATC 2 cut(s) 716, 828
NlaIII CATG 4 cut(s) 145, 289, 508, 823
NlaIV GGNNCC 2 cut(s) 366, 644
PagI TCATGA 1 cut(s) 285
PasI CCCWGGG 1 cut(s) 646
PfeI GAWTC 5 cut(s) 21, 63, 442, 598, 767
PkrI GCNGC 5 cut(s) 128, 179, 313, 450, 453
PleI GAGTC 2 cut(s) 290, 709
PpsI GAGTC 2 cut(s) 290, 709
PshBI ATTAAT 1 cut(s) 383
PsiI TTATAA 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 645
PspGI CCWGG 1 cut(s) 645
PspN4I GGNNCC 2 cut(s) 366, 644
PspPI GGNCC 2 cut(s) 234, 642
PstI CTGCAG 2 cut(s) 450, 480
PstNI CAGNNNCTG 1 cut(s) 445
PsuI RGATCY 1 cut(s) 716
PvuII CAGCTG 2 cut(s) 172, 451
RseI CAYNNNNRTG 3 cut(s) 146, 392, 509
SaqAI TTAA 6 cut(s) 77, 383, 535, 721, 802, 841
SatI GCNGC 5 cut(s) 127, 178, 312, 449, 452
Sau3AI GATC 2 cut(s) 716, 828
Sau96I GGNCC 2 cut(s) 234, 642
SchI GAGTC 2 cut(s) 291, 710
ScrFI CCNGG 3 cut(s) 647, 726, 727
SduI GDGCHC 1 cut(s) 613
SfaNI GCATC 1 cut(s) 318
SfcI CTRYAG 2 cut(s) 446, 476
SinI GGWCC 1 cut(s) 642
SmaI CCCGGG 1 cut(s) 727
SmiMI CAYNNNNRTG 3 cut(s) 146, 392, 509
SpeI ACTAGT 1 cut(s) 834
Sse9I AATT 6 cut(s) 90, 209, 291, 482, 543, 799
SspI AATATT 1 cut(s) 164
SspMI CTAG 5 cut(s) 121, 181, 631, 835, 846
StyD4I CCNGG 3 cut(s) 645, 724, 725
StyI CCWWGG 3 cut(s) 237, 412, 504
TaaI ACNGT 1 cut(s) 199
TaiI ACGT 1 cut(s) 530
TaqI TCGA 3 cut(s) 19, 374, 577
TasI AATT 6 cut(s) 90, 209, 291, 482, 543, 799
TfiI GAWTC 5 cut(s) 21, 63, 442, 598, 767
Tru1I TTAA 6 cut(s) 77, 383, 535, 721, 802, 841
Tru9I TTAA 6 cut(s) 77, 383, 535, 721, 802, 841
TseI GCWGC 5 cut(s) 126, 177, 311, 448, 451
TspDTI ATGAA 8 cut(s) 164, 294, 362, 457, 611, 731, 779, 808
TspMI CCCGGG 1 cut(s) 725
VpaK11BI GGWCC 1 cut(s) 642
VspI ATTAAT 1 cut(s) 383
XapI RAATTY 3 cut(s) 209, 291, 482
XmaI CCCGGG 1 cut(s) 725
XspI CTAG 5 cut(s) 121, 181, 631, 835, 846
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.