Rroxscaffold_4G00320840

Wall-associated receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
49831374 .. 49831703
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00320840.1

Sequence Viewer

Length: 156 bp
ATGGCCTGTTTCGGAGTTAAGGAAGAAAACAAAGAACAAGTCAGAGCAATCGCAGAACTTGCAAAGCAATGCCTCAAGTTGAGTAGTGCAGAAAGACCAACAATGGAAGAAGTGGCCCGAGAGTTAAAGAGGCTCTCGAATTCTTTATCTGAGTAG

Protein Analysis

51

Amino Acids

5.75

Weight (kDa)

6.27

Isoelectric Point (pI)

59.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 139
Ama87I CYCGRG 1 cut(s) 117
AoxI GGCC 2 cut(s) 3, 114
ApoI RAATTY 1 cut(s) 139
ArsI GACNNNNNNTTYG 2 cut(s) 24, 56
AspS9I GGNCC 1 cut(s) 115
AvaI CYCGRG 1 cut(s) 117
BmeT110I CYCGRG 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 115
BpuEI CTTGAG 1 cut(s) 59
Bse3DI GCAATG 1 cut(s) 74
BseMI GCAATG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 141
BsgI GTGCAG 1 cut(s) 108
BshFI GGCC 2 cut(s) 5, 116
BsiHKCI CYCGRG 1 cut(s) 117
BsnI GGCC 2 cut(s) 5, 116
BsoBI CYCGRG 1 cut(s) 117
BspANI GGCC 2 cut(s) 5, 116
BspCNI CTCAG 1 cut(s) 142
BsrDI GCAATG 1 cut(s) 74
BstAPI GCANNNNNTGC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 150
BstMWI GCNNNNNNNGC 1 cut(s) 59
BsuRI GGCC 2 cut(s) 5, 116
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 3 cut(s) 5, 116, 133
CviKI_1 RGCY 3 cut(s) 5, 116, 133
DdeI CTNAG 1 cut(s) 150
Eco88I CYCGRG 1 cut(s) 117
EcoRI GAATTC 1 cut(s) 139
FspEI CC 9 cut(s) 5, 19, 86, 89, 98, 111, 115, 130, 131
HaeIII GGCC 2 cut(s) 5, 116
Hpy188I TCNGA 3 cut(s) 14, 44, 151
Hpy188III TCNNGA 1 cut(s) 136
HpyCH4V TGCA 2 cut(s) 62, 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 150
LpnPI CCDG 1 cut(s) 19
MboII GAAGA 2 cut(s) 35, 119
MluCI AATT 1 cut(s) 139
MnlI CCTC 2 cut(s) 83, 123
MseI TTAA 2 cut(s) 18, 125
MwoI GCNNNNNNNGC 1 cut(s) 59
PspPI GGNCC 1 cut(s) 115
SaqAI TTAA 2 cut(s) 18, 125
Sau96I GGNCC 1 cut(s) 115
SgeI CNNG 7 cut(s) 18, 50, 71, 88, 129, 131, 148
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 1 cut(s) 139
TaqI TCGA 1 cut(s) 137
TasI AATT 1 cut(s) 139
Tru1I TTAA 2 cut(s) 18, 125
Tru9I TTAA 2 cut(s) 18, 125
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.