Rmu_sc0002288.1_g000011

Wall-associated receptor kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002288.1
OG0001114
Physical Location & Seq
Reverse (-)
37206 .. 38603
1398 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002288.1_g000011.1.cds

Sequence Viewer

Length: 1293 bp
atgagcattacaggaaacaccagtaataacagatggaatcaaacttttgcagcaggatactgcaaaagttcttttagaagttcttttagtcagagcgtggaaaagttgcctaagataggacgaagtttcttgtttgatcactcagaaccatttagcagcaaagcagaaaaccttcttaaacgtggtacagtgagaaaaccggaagcttatgatggaatttcaaagacaagacgggaattgtaccacattaaaaatggtaaaggttccagtccatacatctcagtctttccggtaaatctgattcttggtcttggctcttgtttctcgattcttttgtttgtgatatctggggtttatttgagtgtgaagaatctaaggtttattaaagtcaaaaccaatttcttcaagaaaaatggagggatattgctagagcagcatattgcttcacatggagatgaaatgacaacaatatttacagctgagcagctagaaatggctactaactgttaccaaagaattttacgcgataaagtagtggagggccaaggcgagagttttataaatgagattatcgctcttgcccaaatgagtcatgagaatttggtgaagttcattggctgctgtttagagactgatgctcctattttggtttatgaacttgcctctaatggaacccttttcgactgcattaatcacaccaatgggaaagttacattgccttggaatatcctcctaaagatagggtcagaatctgcagctgctcttgcttatattcattcttctgcaggaattcactccaaacacatcatccatggcaatgtcaagtcttccaacgtattgttaactgataatttcacggccaaagtctcaggtttttggccttcgaggttagtccctgctaatgaatctcagatgggcacattgcttctaaggacactaggttatatggacccagggtatctttgcacaggtcaactgacagatgagagtgatgtttatagcttcggagtcgttttggtagagatcttaacccgggaaaagcctatttcatttgacagaccagaaagtcaaagaatcattgcctctcattttgtttcatccattgaattaaaagatggtttctttcatgttgttgatccactagttttaaacgagggaaatcgagaacaagtaagagcagttgcagagcttgcaaagagatgcctccatatgaacagtgaggaaaggccttcaatgaaagaagtcgctggagagttgcagaggctgtctggcatgtgtcctacagtagtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EGF EGF_CA GUB_WAK_bind Pkinase Pkinase_Tyr WAK

Protein Analysis

430

Amino Acids

47.76

Weight (kDa)

8.28

Isoelectric Point (pI)

42.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 560
AasI GACNNNNNNGTC 1 cut(s) 1065
AccII CGCG 1 cut(s) 525
AclWI GGATC 1 cut(s) 1130
AcoI YGGCCR 1 cut(s) 858
AcsI RAATTY 4 cut(s) 216, 516, 598, 789
AfaI GTAC 2 cut(s) 187, 242
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 4 cut(s) 222, 406, 1106, 1233
AhlI ACTAGT 1 cut(s) 1141
AjnI CCWGG 1 cut(s) 952
AluBI AGCT 6 cut(s) 206, 479, 487, 758, 1002, 1189
AluI AGCT 6 cut(s) 206, 479, 487, 758, 1002, 1189
Alw26I GTCTC 2 cut(s) 623, 871
AlwI GGATC 1 cut(s) 1130
AlwNI CAGNNNCTG 2 cut(s) 752, 1264
Ama87I CYCGRG 1 cut(s) 1032
AoxI GGCC 4 cut(s) 541, 858, 878, 1226
ApeKI GCWGC 7 cut(s) 50, 156, 433, 484, 618, 755, 758
ApoI RAATTY 4 cut(s) 216, 516, 598, 789
AseI ATTAAT 1 cut(s) 690
Asp700I GAANNNNTTC 1 cut(s) 171
AspS9I GGNCC 2 cut(s) 541, 949
AsuC2I CCSGG 2 cut(s) 1033, 1034
AsuHPI GGTGA 1 cut(s) 616
AvaI CYCGRG 1 cut(s) 1032
AvaII GGWCC 1 cut(s) 949
BaeGI GKGCMC 1 cut(s) 920
BbsI GAAGAC 1 cut(s) 819
BbvI GCAGC 7 cut(s) 62, 168, 445, 496, 605, 745, 767
BccI CCATC 4 cut(s) 27, 206, 907, 1109
BceAI ACGGC 1 cut(s) 873
BciT130I CCWGG 1 cut(s) 954
BciVI GTATCC 1 cut(s) 50
BclI TGATCA 1 cut(s) 136
BcnI CCSGG 2 cut(s) 1033, 1034
BcoDI GTCTC 2 cut(s) 623, 871
BcuI ACTAGT 1 cut(s) 1141
BfaI CTAG 4 cut(s) 428, 488, 938, 1142
BfmI CTRYAG 3 cut(s) 753, 783, 1281
BfuI GTATCC 1 cut(s) 50
BglII AGATCT 1 cut(s) 1023
BisI GCNGC 7 cut(s) 51, 157, 434, 485, 619, 756, 759
BlpI GCTNAGC 1 cut(s) 480
BlsI GCNGC 7 cut(s) 52, 158, 435, 486, 620, 757, 760
Bme1390I CCNGG 3 cut(s) 954, 1033, 1034
Bme18I GGWCC 1 cut(s) 949
BmeT110I CYCGRG 1 cut(s) 1032
BmgT120I GGNCC 2 cut(s) 541, 949
BmiI GGNNCC 3 cut(s) 265, 673, 951
BmrFI CCNGG 3 cut(s) 954, 1033, 1034
BmsI GCATC 2 cut(s) 625, 1190
BpiI GAAGAC 1 cut(s) 819
BpmI CTGGAG 1 cut(s) 1269
Bpu1102I GCTNAGC 1 cut(s) 480
BpuMI CCSGG 2 cut(s) 1033, 1034
BsaJI CCNNGG 6 cut(s) 544, 719, 811, 952, 953, 1032
BsaWI WCCGGW 2 cut(s) 199, 289
BsaXI ACNNNNNCTCC 2 cut(s) 622, 652
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 2 cut(s) 21, 267
Bse3DI GCAATG 4 cut(s) 713, 823, 920, 1077
BseBI CCWGG 1 cut(s) 954
BseDI CCNNGG 6 cut(s) 544, 719, 811, 952, 953, 1032
BseGI GGATG 2 cut(s) 807, 1097
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMI GCAATG 4 cut(s) 713, 823, 920, 1077
BseMII CTCAG 5 cut(s) 156, 294, 471, 882, 923
BseNI ACTGG 2 cut(s) 21, 267
BseSI GKGCMC 1 cut(s) 920
BseXI GCAGC 7 cut(s) 62, 168, 445, 496, 605, 745, 767
Bsh1236I CGCG 1 cut(s) 525
BshFI GGCC 4 cut(s) 543, 860, 880, 1228
BsiHKCI CYCGRG 1 cut(s) 1032
BsiSI CCGG 3 cut(s) 200, 290, 1033
BslFI GGGAC 1 cut(s) 878
BslI CCNNNNNNNGG 1 cut(s) 116
BsmAI GTCTC 2 cut(s) 623, 871
BsmFI GGGAC 1 cut(s) 878
BsnI GGCC 4 cut(s) 543, 860, 880, 1228
BsoBI CYCGRG 1 cut(s) 1032
Bsp1286I GDGCHC 1 cut(s) 920
Bsp143I GATC 3 cut(s) 136, 1023, 1135
Bsp1720I GCTNAGC 1 cut(s) 480
Bsp19I CCATGG 1 cut(s) 811
BspANI GGCC 4 cut(s) 543, 860, 880, 1228
BspCNI CTCAG 5 cut(s) 155, 293, 472, 881, 922
BspFNI CGCG 1 cut(s) 525
BspHI TCATGA 1 cut(s) 592
BspLI GGNNCC 3 cut(s) 265, 673, 951
BspMAI CTGCAG 2 cut(s) 757, 787
BspPI GGATC 1 cut(s) 1130
BsrDI GCAATG 4 cut(s) 713, 823, 920, 1077
BsrI ACTGG 2 cut(s) 21, 267
BssECI CCNNGG 6 cut(s) 544, 719, 811, 952, 953, 1032
BssMI GATC 3 cut(s) 136, 1023, 1135
BssT1I CCWWGG 3 cut(s) 544, 719, 811
Bst2UI CCWGG 1 cut(s) 954
Bst4CI ACNGT 4 cut(s) 190, 506, 1217, 1285
BstAPI GCANNNNNTGC 1 cut(s) 1190
BstC8I GCNNGC 1 cut(s) 1191
BstDEI CTNAG 8 cut(s) 111, 142, 280, 374, 480, 868, 909, 929
BstDSI CCRYGG 1 cut(s) 811
BstENI CCTNNNNNAGG 1 cut(s) 114
BstF5I GGATG 2 cut(s) 807, 1097
BstFNI CGCG 1 cut(s) 525
BstKTI GATC 3 cut(s) 139, 1026, 1138
BstMAI GTCTC 2 cut(s) 623, 871
BstMBI GATC 3 cut(s) 136, 1023, 1135
BstMWI GCNNNNNNNGC 3 cut(s) 433, 764, 1190
BstNI CCWGG 1 cut(s) 954
BstNSI RCATGY 1 cut(s) 1276
BstSCI CCNGG 3 cut(s) 952, 1031, 1032
BstSFI CTRYAG 3 cut(s) 753, 783, 1281
BstSLI GKGCMC 1 cut(s) 920
BstUI CGCG 1 cut(s) 525
BstV1I GCAGC 7 cut(s) 62, 168, 445, 496, 605, 745, 767
BstV2I GAAGAC 1 cut(s) 819
BstX2I RGATCY 1 cut(s) 1023
BstYI RGATCY 1 cut(s) 1023
BsuI GTATCC 1 cut(s) 50
BsuRI GGCC 4 cut(s) 543, 860, 880, 1228
BtgI CCRYGG 1 cut(s) 811
BtsCI GGATG 2 cut(s) 807, 1097
BtsIMutI CAGTG 2 cut(s) 195, 1222
Cac8I GCNNGC 1 cut(s) 1191
CaiI CAGNNNCTG 2 cut(s) 752, 1264
CciI TCATGA 1 cut(s) 592
Cfr13I GGNCC 2 cut(s) 541, 949
Cfr9I CCCGGG 1 cut(s) 1032
Csp6I GTAC 2 cut(s) 186, 241
CviAII CATG 5 cut(s) 449, 593, 812, 1127, 1273
CviQI GTAC 2 cut(s) 186, 241
DdeI CTNAG 8 cut(s) 111, 142, 280, 374, 480, 868, 909, 929
DpnI GATC 3 cut(s) 138, 1025, 1137
DpnII GATC 3 cut(s) 136, 1023, 1135
DraI TTTAAA 1 cut(s) 1149
DrdI GACNNNNNNGTC 1 cut(s) 1065
DseDI GACNNNNNNGTC 1 cut(s) 1065
EaeI YGGCCR 1 cut(s) 858
Eco130I CCWWGG 3 cut(s) 544, 719, 811
Eco147I AGGCCT 1 cut(s) 1228
Eco32I GATATC 1 cut(s) 345
Eco47I GGWCC 1 cut(s) 949
Eco88I CYCGRG 1 cut(s) 1032
EcoNI CCTNNNNNAGG 1 cut(s) 114
EcoRI GAATTC 1 cut(s) 789
EcoRII CCWGG 1 cut(s) 952
EcoRV GATATC 1 cut(s) 345
EcoT14I CCWWGG 3 cut(s) 544, 719, 811
ErhI CCWWGG 3 cut(s) 544, 719, 811
FaeI CATG 5 cut(s) 452, 596, 815, 1130, 1276
FaqI GGGAC 1 cut(s) 878
FatI CATG 5 cut(s) 448, 592, 811, 1126, 1272
FauNDI CATATG 1 cut(s) 1209
FbaI TGATCA 1 cut(s) 136
Fnu4HI GCNGC 7 cut(s) 51, 157, 434, 485, 619, 756, 759
FokI GGATG 2 cut(s) 794, 1084
Fsp4HI GCNGC 7 cut(s) 51, 157, 434, 485, 619, 756, 759
FspBI CTAG 4 cut(s) 428, 488, 938, 1142
GluI GCNGC 7 cut(s) 51, 157, 434, 485, 619, 756, 759
GsuI CTGGAG 1 cut(s) 1269
HaeIII GGCC 4 cut(s) 543, 860, 880, 1228
HapII CCGG 3 cut(s) 200, 290, 1033
Hin1II CATG 5 cut(s) 452, 596, 815, 1130, 1276
HincII GTYRAC 2 cut(s) 843, 974
HindII GTYRAC 2 cut(s) 843, 974
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 9 cut(s) 37, 301, 328, 370, 589, 749, 905, 1008, 1074
HpaI GTTAAC 1 cut(s) 843
HpaII CCGG 3 cut(s) 200, 290, 1033
HphI GGTGA 1 cut(s) 616
Hpy166II GTNNAC 2 cut(s) 843, 974
Hpy188I TCNGA 7 cut(s) 93, 145, 300, 748, 912, 1007, 1292
Hpy188III TCNNGA 4 cut(s) 325, 406, 593, 1163
Hpy8I GTNNAC 2 cut(s) 843, 974
HpyAV CCTTC 3 cut(s) 182, 891, 1239
HpyCH4III ACNGT 4 cut(s) 190, 506, 1217, 1285
HpyCH4IV ACGT 2 cut(s) 181, 834
HpyCH4V TGCA 9 cut(s) 50, 63, 687, 755, 785, 966, 1184, 1193, 1258
HpyF10VI GCNNNNNNNGC 3 cut(s) 433, 764, 1190
HpyF3I CTNAG 8 cut(s) 111, 142, 280, 374, 480, 868, 909, 929
HpySE526I ACGT 2 cut(s) 181, 834
Hsp92II CATG 5 cut(s) 452, 596, 815, 1130, 1276
Ksp22I TGATCA 1 cut(s) 136
KspAI GTTAAC 1 cut(s) 843
Kzo9I GATC 3 cut(s) 136, 1023, 1135
LmnI GCTCC 1 cut(s) 643
Lsp1109I GCAGC 7 cut(s) 62, 168, 445, 496, 605, 745, 767
LweI GCATC 2 cut(s) 625, 1190
MaeI CTAG 4 cut(s) 428, 488, 938, 1142
MaeII ACGT 2 cut(s) 181, 834
MaeIII GTNAC 2 cut(s) 506, 709
MalI GATC 3 cut(s) 138, 1025, 1137
MboI GATC 3 cut(s) 136, 1023, 1135
MboII GAAGA 4 cut(s) 379, 394, 771, 819
MflI RGATCY 1 cut(s) 1023
MhlI GDGCHC 1 cut(s) 920
MluCI AATT 8 cut(s) 216, 236, 397, 516, 598, 789, 850, 1106
MlyI GAGTC 2 cut(s) 598, 1017
MmeI TCCRAC 1 cut(s) 855
MroXI GAANNNNTTC 1 cut(s) 171
MseI TTAA 8 cut(s) 177, 249, 384, 690, 842, 1028, 1109, 1148
MslI CAYNNNNRTG 3 cut(s) 453, 699, 816
MspA1I CMGCKG 2 cut(s) 479, 758
MspI CCGG 3 cut(s) 200, 290, 1033
MspR9I CCNGG 3 cut(s) 954, 1033, 1034
MvaI CCWGG 1 cut(s) 954
MvnI CGCG 1 cut(s) 525
MwoI GCNNNNNNNGC 3 cut(s) 433, 764, 1190
NciI CCSGG 2 cut(s) 1033, 1034
NcoI CCATGG 1 cut(s) 811
NdeI CATATG 1 cut(s) 1209
NdeII GATC 3 cut(s) 136, 1023, 1135
NlaIII CATG 5 cut(s) 452, 596, 815, 1130, 1276
NlaIV GGNNCC 3 cut(s) 265, 673, 951
NspI RCATGY 1 cut(s) 1276
PagI TCATGA 1 cut(s) 592
PasI CCCWGGG 1 cut(s) 953
PceI AGGCCT 1 cut(s) 1228
PdmI GAANNNNTTC 1 cut(s) 171
PfeI GAWTC 7 cut(s) 37, 301, 328, 370, 749, 905, 1074
PkrI GCNGC 7 cut(s) 52, 158, 435, 486, 620, 757, 760
PleI GAGTC 2 cut(s) 597, 1016
PpsI GAGTC 2 cut(s) 597, 1016
PshBI ATTAAT 1 cut(s) 690
PsiI TTATAA 1 cut(s) 560
Psp6I CCWGG 1 cut(s) 952
PspGI CCWGG 1 cut(s) 952
PspN4I GGNNCC 3 cut(s) 265, 673, 951
PspPI GGNCC 2 cut(s) 541, 949
PstI CTGCAG 2 cut(s) 757, 787
PstNI CAGNNNCTG 2 cut(s) 752, 1264
PsuI RGATCY 1 cut(s) 1023
PvuII CAGCTG 2 cut(s) 479, 758
RsaI GTAC 2 cut(s) 187, 242
RsaNI GTAC 2 cut(s) 186, 241
RseI CAYNNNNRTG 3 cut(s) 453, 699, 816
SaqAI TTAA 8 cut(s) 177, 249, 384, 690, 842, 1028, 1109, 1148
SatI GCNGC 7 cut(s) 51, 157, 434, 485, 619, 756, 759
Sau3AI GATC 3 cut(s) 136, 1023, 1135
Sau96I GGNCC 2 cut(s) 541, 949
SchI GAGTC 2 cut(s) 598, 1017
ScrFI CCNGG 3 cut(s) 954, 1033, 1034
SduI GDGCHC 1 cut(s) 920
SfaNI GCATC 2 cut(s) 625, 1190
SfcI CTRYAG 3 cut(s) 753, 783, 1281
SinI GGWCC 1 cut(s) 949
SmaI CCCGGG 1 cut(s) 1034
SmiMI CAYNNNNRTG 3 cut(s) 453, 699, 816
SpeI ACTAGT 1 cut(s) 1141
Sse9I AATT 8 cut(s) 216, 236, 397, 516, 598, 789, 850, 1106
SseBI AGGCCT 1 cut(s) 1228
SspI AATATT 1 cut(s) 471
SspMI CTAG 4 cut(s) 428, 488, 938, 1142
StuI AGGCCT 1 cut(s) 1228
StyD4I CCNGG 3 cut(s) 952, 1031, 1032
StyI CCWWGG 3 cut(s) 544, 719, 811
TaaI ACNGT 4 cut(s) 190, 506, 1217, 1285
TaiI ACGT 2 cut(s) 184, 837
TaqI TCGA 4 cut(s) 326, 681, 884, 1162
TasI AATT 8 cut(s) 216, 236, 397, 516, 598, 789, 850, 1106
TfiI GAWTC 7 cut(s) 37, 301, 328, 370, 749, 905, 1074
Tru1I TTAA 8 cut(s) 177, 249, 384, 690, 842, 1028, 1109, 1148
Tru9I TTAA 8 cut(s) 177, 249, 384, 690, 842, 1028, 1109, 1148
TscAI CASTG 2 cut(s) 195, 1222
TseI GCWGC 7 cut(s) 50, 156, 433, 484, 618, 755, 758
TspMI CCCGGG 1 cut(s) 1032
TspRI CASTG 2 cut(s) 195, 1222
VpaK11BI GGWCC 1 cut(s) 949
VspI ATTAAT 1 cut(s) 690
XagI CCTNNNNNAGG 1 cut(s) 114
XapI RAATTY 4 cut(s) 216, 516, 598, 789
XceI RCATGY 1 cut(s) 1276
XcmI CCANNNNNNNNNTGG 1 cut(s) 251
XmaI CCCGGG 1 cut(s) 1032
XmnI GAANNNNTTC 1 cut(s) 171
XspI CTAG 4 cut(s) 428, 488, 938, 1142
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.