Rmu_sc0000285.1_g000006

Belongs to the short-chain dehydrogenases reductases (SDR) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000285.1
Physical Location & Seq
Reverse (-)
20238 .. 21631
1394 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000285.1_g000006.1.cds

Sequence Viewer

Length: 972 bp
atggaattacaagaatttttcatagtcctagcaatcactatagggttggtatctgtttgtatatctttgatcaattttgcgagatggatatgggtcatgtttctgagaccttcaaagaaactcaaggagtacggatcatgggctattatcactggctccgctcaaggaattgggaaagcccttgcctttgaaatggcttcaaagggtctcaacattttcttggttgataaaaaccattcaacccttgaagctacctccaatgaattaagtgaaaaacatggttggatagttgagatcaagagcattgtcatggacttggccaaattgagtggtgaggagatagctaaaaccatagaggaaggaacgaaagggctcgatgttggcattttggttaataatgcagggatgtgttacccttatccaaggttttttcatgaggttgattcagaactcatggagaacattatgaaggtgaacatggaagcagcaacttggatgactaaggctgtgcttccgggaatgctgaagaaaaagaaaggagcaattgtcaacattggctctgcttccactgagatagccccttcttttcctctgtacactctttatgccacaacaaaagcgtacctaaaactgttctcaagatgcattagtttggaatacaatcagcatggaattgacattcagtgtcaggttcctgtgttcgtcgcgacaagactaacgaagataaaggaatcttccttgttcatcccatcaccagaaacttttagcaaatcaagcattcggtggattggttatgacaatgtttgtacgccgtactggagccactctgtgatgggatttgtagcccgtgcattgccccatgctctcctgaccgccaccatttttcggtatttccttggtaacagaaagagaggccaattgaatgagttgcagaagaaaaatatactgcaaccacagagcaatcaactatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

323

Amino Acids

36.25

Weight (kDa)

9.13

Isoelectric Point (pI)

37.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 161
AccII CGCG 1 cut(s) 707
AciI CCGC 2 cut(s) 159, 873
AclWI GGATC 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 318
AcsI RAATTY 1 cut(s) 14
AcuI CTGAAG 1 cut(s) 545
AdeI CACNNNGTG 1 cut(s) 829
AfaI GTAC 5 cut(s) 131, 596, 623, 808, 815
AfiI CCNNNNNNNGG 1 cut(s) 885
AgsI TTSAA 6 cut(s) 114, 191, 201, 240, 248, 922
AluBI AGCT 2 cut(s) 251, 344
AluI AGCT 2 cut(s) 251, 344
Alw26I GTCTC 2 cut(s) 100, 212
AlwI GGATC 1 cut(s) 142
AoxI GGCC 2 cut(s) 318, 913
ApeKI GCWGC 1 cut(s) 485
ApoI RAATTY 1 cut(s) 14
AsuC2I CCSGG 1 cut(s) 516
AsuHPI GGTGA 3 cut(s) 344, 484, 744
BalI TGGCCA 1 cut(s) 320
BanII GRGCYC 1 cut(s) 375
BbvI GCAGC 1 cut(s) 497
BccI CCATC 3 cut(s) 78, 757, 826
BceAI ACGGC 1 cut(s) 796
BclI TGATCA 1 cut(s) 69
BcnI CCSGG 1 cut(s) 516
BcoDI GTCTC 2 cut(s) 100, 212
BfaI CTAG 1 cut(s) 29
BfmI CTRYAG 2 cut(s) 39, 968
BisI GCNGC 1 cut(s) 486
BlsI GCNGC 1 cut(s) 487
Bme1390I CCNGG 1 cut(s) 516
BmiI GGNNCC 3 cut(s) 157, 693, 821
BmrFI CCNGG 1 cut(s) 516
BmsI GCATC 1 cut(s) 632
BpmI CTGGAG 1 cut(s) 838
BpuEI CTTGAG 3 cut(s) 107, 147, 622
BpuMI CCSGG 1 cut(s) 516
BsaI GGTCTC 2 cut(s) 100, 212
BsaJI CCNNGG 2 cut(s) 422, 895
BsaXI ACNNNNNCTCC 2 cut(s) 531, 561
Bsc4I CCNNNNNNNGG 1 cut(s) 885
Bse1I ACTGG 2 cut(s) 157, 821
Bse3DI GCAATG 1 cut(s) 851
BseDI CCNNGG 2 cut(s) 422, 895
BseGI GGATG 3 cut(s) 411, 501, 744
BseLI CCNNNNNNNGG 1 cut(s) 885
BseMI GCAATG 1 cut(s) 851
BseMII CTCAG 2 cut(s) 95, 561
BseNI ACTGG 2 cut(s) 157, 821
BseRI GAGGAG 1 cut(s) 350
BseXI GCAGC 1 cut(s) 497
Bsh1236I CGCG 1 cut(s) 707
BshFI GGCC 2 cut(s) 320, 915
BsiSI CCGG 1 cut(s) 515
BslI CCNNNNNNNGG 1 cut(s) 885
BsmAI GTCTC 2 cut(s) 100, 212
BsmI GAATGC 2 cut(s) 525, 777
BsnI GGCC 2 cut(s) 320, 915
Bso31I GGTCTC 2 cut(s) 100, 212
Bsp1286I GDGCHC 1 cut(s) 375
Bsp1407I TGTACA 1 cut(s) 594
Bsp143I GATC 3 cut(s) 69, 134, 294
Bsp68I TCGCGA 1 cut(s) 707
BspACI CCGC 2 cut(s) 159, 873
BspANI GGCC 2 cut(s) 320, 915
BspCNI CTCAG 2 cut(s) 96, 562
BspFNI CGCG 1 cut(s) 707
BspHI TCATGA 1 cut(s) 433
BspLI GGNNCC 3 cut(s) 157, 693, 821
BspPI GGATC 1 cut(s) 142
BspTNI GGTCTC 2 cut(s) 100, 212
BsrBI CCGCTC 1 cut(s) 161
BsrDI GCAATG 1 cut(s) 851
BsrGI TGTACA 1 cut(s) 594
BsrI ACTGG 2 cut(s) 157, 821
BssECI CCNNGG 2 cut(s) 422, 895
BssMI GATC 3 cut(s) 69, 134, 294
BssT1I CCWWGG 2 cut(s) 422, 895
Bst4CI ACNGT 1 cut(s) 633
BstAUI TGTACA 1 cut(s) 594
BstDEI CTNAG 3 cut(s) 104, 501, 570
BstF5I GGATG 3 cut(s) 411, 501, 744
BstFNI CGCG 1 cut(s) 707
BstKTI GATC 3 cut(s) 72, 137, 297
BstMAI GTCTC 2 cut(s) 100, 212
BstMBI GATC 3 cut(s) 69, 134, 294
BstMWI GCNNNNNNNGC 1 cut(s) 774
BstSCI CCNGG 1 cut(s) 514
BstSFI CTRYAG 2 cut(s) 39, 968
BstUI CGCG 1 cut(s) 707
BstV1I GCAGC 1 cut(s) 497
BsuRI GGCC 2 cut(s) 320, 915
BtsCI GGATG 3 cut(s) 411, 501, 744
BtsIMutI CAGTG 3 cut(s) 150, 567, 689
BtuMI TCGCGA 1 cut(s) 707
CciI TCATGA 1 cut(s) 433
Csp6I GTAC 5 cut(s) 130, 595, 622, 807, 814
CspCI CAANNNNNGTGG 2 cut(s) 310, 345
CviAII CATG 9 cut(s) 97, 138, 278, 310, 434, 454, 478, 668, 860
CviQI GTAC 5 cut(s) 130, 595, 622, 807, 814
DdeI CTNAG 3 cut(s) 104, 501, 570
DpnI GATC 3 cut(s) 71, 136, 296
DpnII GATC 3 cut(s) 69, 134, 294
DraIII CACNNNGTG 1 cut(s) 829
EaeI YGGCCR 1 cut(s) 318
Eco130I CCWWGG 2 cut(s) 422, 895
Eco24I GRGCYC 1 cut(s) 375
Eco31I GGTCTC 2 cut(s) 100, 212
Eco57I CTGAAG 1 cut(s) 545
EcoT14I CCWWGG 2 cut(s) 422, 895
EcoT22I ATGCAT 1 cut(s) 647
EcoT38I GRGCYC 1 cut(s) 375
ErhI CCWWGG 2 cut(s) 422, 895
FaeI CATG 9 cut(s) 100, 141, 281, 313, 437, 457, 481, 671, 863
FatI CATG 9 cut(s) 96, 137, 277, 309, 433, 453, 477, 667, 859
FbaI TGATCA 1 cut(s) 69
Fnu4HI GCNGC 1 cut(s) 486
FokI GGATG 3 cut(s) 418, 508, 731
FriOI GRGCYC 1 cut(s) 375
Fsp4HI GCNGC 1 cut(s) 486
FspBI CTAG 1 cut(s) 29
GluI GCNGC 1 cut(s) 486
GsuI CTGGAG 1 cut(s) 838
HaeIII GGCC 2 cut(s) 320, 915
HapII CCGG 1 cut(s) 515
Hin1II CATG 9 cut(s) 100, 141, 281, 313, 437, 457, 481, 671, 863
HincII GTYRAC 1 cut(s) 550
HindII GTYRAC 1 cut(s) 550
HinfI GANTC 2 cut(s) 443, 731
HpaII CCGG 1 cut(s) 515
HphI GGTGA 3 cut(s) 344, 484, 744
Hpy166II GTNNAC 3 cut(s) 475, 550, 597
Hpy188I TCNGA 2 cut(s) 105, 448
Hpy188III TCNNGA 5 cut(s) 298, 434, 639, 706, 868
Hpy8I GTNNAC 3 cut(s) 475, 550, 597
Hpy99I CGWCG 1 cut(s) 707
HpyAV CCTTC 4 cut(s) 120, 353, 463, 591
HpyCH4III ACNGT 1 cut(s) 633
HpyCH4V TGCA 5 cut(s) 401, 645, 851, 931, 949
HpyF10VI GCNNNNNNNGC 1 cut(s) 774
HpyF3I CTNAG 3 cut(s) 104, 501, 570
Hsp92II CATG 9 cut(s) 100, 141, 281, 313, 437, 457, 481, 671, 863
Ksp22I TGATCA 1 cut(s) 69
Kzo9I GATC 3 cut(s) 69, 134, 294
LmnI GCTCC 3 cut(s) 161, 539, 819
LpnPI CCDG 8 cut(s) 138, 387, 528, 674, 708, 768, 802, 881
Lsp1109I GCAGC 1 cut(s) 497
LweI GCATC 1 cut(s) 632
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 2 cut(s) 410, 899
MalI GATC 3 cut(s) 71, 136, 296
MbiI CCGCTC 1 cut(s) 161
MboI GATC 3 cut(s) 69, 134, 294
MboII GAAGA 4 cut(s) 538, 726, 733, 946
MfeI CAATTG 2 cut(s) 543, 917
MhlI GDGCHC 1 cut(s) 375
MlsI TGGCCA 1 cut(s) 320
MluCI AATT 9 cut(s) 5, 14, 73, 168, 263, 323, 543, 672, 917
MluNI TGGCCA 1 cut(s) 320
MmeI TCCRAC 1 cut(s) 263
MnlI CCTC 6 cut(s) 265, 328, 349, 430, 600, 905
Mox20I TGGCCA 1 cut(s) 320
Mph1103I ATGCAT 1 cut(s) 647
MscI TGGCCA 1 cut(s) 320
MseI TTAA 2 cut(s) 266, 393
MslI CAYNNNNRTG 1 cut(s) 308
Msp20I TGGCCA 1 cut(s) 320
MspI CCGG 1 cut(s) 515
MspR9I CCNGG 1 cut(s) 516
MunI CAATTG 2 cut(s) 543, 917
Mva1269I GAATGC 2 cut(s) 525, 777
MvnI CGCG 1 cut(s) 707
MwoI GCNNNNNNNGC 1 cut(s) 774
NciI CCSGG 1 cut(s) 516
NdeII GATC 3 cut(s) 69, 134, 294
NlaIII CATG 9 cut(s) 100, 141, 281, 313, 437, 457, 481, 671, 863
NlaIV GGNNCC 3 cut(s) 157, 693, 821
NruI TCGCGA 1 cut(s) 707
NsiI ATGCAT 1 cut(s) 647
PagI TCATGA 1 cut(s) 433
PctI GAATGC 2 cut(s) 525, 777
PfeI GAWTC 2 cut(s) 443, 731
PfoI TCCNGGA 1 cut(s) 514
PkrI GCNGC 1 cut(s) 487
PspN4I GGNNCC 3 cut(s) 157, 693, 821
RruI TCGCGA 1 cut(s) 707
RsaI GTAC 5 cut(s) 131, 596, 623, 808, 815
RsaNI GTAC 5 cut(s) 130, 595, 622, 807, 814
RseI CAYNNNNRTG 1 cut(s) 308
SaqAI TTAA 2 cut(s) 266, 393
SatI GCNGC 1 cut(s) 486
Sau3AI GATC 3 cut(s) 69, 134, 294
ScrFI CCNGG 1 cut(s) 516
SduI GDGCHC 1 cut(s) 375
SetI ASST 9 cut(s) 112, 253, 257, 346, 428, 441, 474, 627, 693
SfaNI GCATC 1 cut(s) 632
SfcI CTRYAG 2 cut(s) 39, 968
SmiMI CAYNNNNRTG 1 cut(s) 308
SmlI CTYRAG 3 cut(s) 122, 162, 637
SmoI CTYRAG 3 cut(s) 122, 162, 637
Sse9I AATT 9 cut(s) 5, 14, 73, 168, 263, 323, 543, 672, 917
SsiI CCGC 2 cut(s) 159, 873
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 514
StyI CCWWGG 2 cut(s) 422, 895
TaaI ACNGT 1 cut(s) 633
TaqI TCGA 1 cut(s) 375
TasI AATT 9 cut(s) 5, 14, 73, 168, 263, 323, 543, 672, 917
TatI WGTACW 1 cut(s) 594
TfiI GAWTC 2 cut(s) 443, 731
Tru1I TTAA 2 cut(s) 266, 393
Tru9I TTAA 2 cut(s) 266, 393
TscAI CASTG 3 cut(s) 157, 574, 689
TseI GCWGC 1 cut(s) 485
TspDTI ATGAA 5 cut(s) 10, 276, 422, 482, 733
TspGWI ACGGA 1 cut(s) 147
TspRI CASTG 3 cut(s) 157, 574, 689
XapI RAATTY 1 cut(s) 14
XspI CTAG 1 cut(s) 29
Zsp2I ATGCAT 1 cut(s) 647
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.