Rmu_sc0000588.1_g000003

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000588.1
OG0001771
Physical Location & Seq
Forward (+)
10894 .. 12285
1392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000588.1_g000003.1.cds

Sequence Viewer

Length: 441 bp
atgttggattctccgcacagatcaaaatttacagaagcagataacactcatattggttctttcaagtcaacatctaatgaatatccactggctccaacatcaccaagtgatgaacctgtcagtgtctgtcctgatactccacgtccttcaaacgggaacagagaggtggtgtttgggggtaaagatgaaatatcctcactgaacaaggttataattaaagatgaaactcgtgacgctacacatgcttcgagtcgagtgggcaggggtaaaaacccttatgcaatgtcagtcttgagactagttcagatgaaactagatggtcgggatatatctgacgacagagaaatcagtatctccaaacaagtggactatctacctaagcaagccactagcgcagacaatctttgcaacatgtatgaaggttggacaccatggatttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0000184 GO:0000956 GO:0003674 GO:0003676 GO:0003677 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005737 GO:0006139 GO:0006259 GO:0006281 GO:0006401 GO:0006402 GO:0006464 GO:0006468 GO:0006629 GO:0006644 GO:0006650 GO:0006725 GO:0006793 GO:0006796 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009892 GO:0009987 GO:0010468 GO:0010605 GO:0010629 GO:0016070 GO:0016071 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0018105 GO:0018193 GO:0018209 GO:0019219 GO:0019222 GO:0019439 GO:0019538 GO:0019637 GO:0030258 GO:0031323 GO:0031974 GO:0031981 GO:0032204 GO:0033043 GO:0033044 GO:0033554 GO:0034641 GO:0034655 GO:0036211 GO:0042162 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0043412 GO:0043565 GO:0044237 GO:0044238 GO:0044248 GO:0044255 GO:0044260 GO:0044265 GO:0044267 GO:0044270 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0046483 GO:0046486 GO:0046488 GO:0046700 GO:0046777 GO:0046834 GO:0046854 GO:0048519 GO:0048583 GO:0050789 GO:0050794 GO:0050896 GO:0051052 GO:0051128 GO:0051171 GO:0051716 GO:0060255 GO:0065007 GO:0065008 GO:0070013 GO:0071704 GO:0080090 GO:0080134 GO:0080135 GO:0090304 GO:0097159 GO:0140096 GO:1901360 GO:1901361 GO:1901363 GO:1901564 GO:1901575 GO:2001020
KEGG Pathways
Metabolic & Signaling
ko03015 map03015
Pfam Domains
Protein Families
FATC PI3_PI4_kinase SMG1 WD40

Protein Analysis

146

Amino Acids

16.21

Weight (kDa)

5.59

Isoelectric Point (pI)

42.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 212
AciI CCGC 1 cut(s) 14
AcsI RAATTY 1 cut(s) 26
AdeI CACNNNGTG 1 cut(s) 107
AfiI CCNNNNNNNGG 1 cut(s) 152
AflIII ACRYGT 1 cut(s) 411
AgsI TTSAA 2 cut(s) 64, 150
AhlI ACTAGT 1 cut(s) 298
AjiI CACGTC 1 cut(s) 143
Alw26I GTCTC 1 cut(s) 289
AlwNI CAGNNNCTG 1 cut(s) 126
ApoI RAATTY 1 cut(s) 26
AspLEI GCGC 1 cut(s) 395
AsuHPI GGTGA 1 cut(s) 93
BauI CACGAG 1 cut(s) 228
BccI CCATC 1 cut(s) 311
BcoDI GTCTC 1 cut(s) 289
BcuI ACTAGT 1 cut(s) 298
BfaI CTAG 3 cut(s) 299, 314, 390
BmgBI CACGTC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 93
Bpu10I CCTNAGC 1 cut(s) 378
BpuEI CTTGAG 1 cut(s) 313
BsaJI CCNNGG 1 cut(s) 431
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 93
Bse3DI GCAATG 1 cut(s) 288
BseDI CCNNGG 1 cut(s) 431
BseLI CCNNNNNNNGG 1 cut(s) 152
BseMI GCAATG 1 cut(s) 288
BseNI ACTGG 1 cut(s) 93
BslI CCNNNNNNNGG 1 cut(s) 152
BsmAI GTCTC 1 cut(s) 289
Bsp143I GATC 1 cut(s) 20
Bsp19I CCATGG 1 cut(s) 431
BspACI CCGC 1 cut(s) 14
BspLI GGNNCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 288
BsrI ACTGG 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 431
BssMI GATC 1 cut(s) 20
BssSI CACGAG 1 cut(s) 228
BssT1I CCWWGG 1 cut(s) 431
Bst2BI CACGAG 1 cut(s) 228
BstC8I GCNNGC 1 cut(s) 384
BstDEI CTNAG 1 cut(s) 378
BstDSI CCRYGG 1 cut(s) 431
BstHHI GCGC 1 cut(s) 395
BstKTI GATC 1 cut(s) 23
BstMAI GTCTC 1 cut(s) 289
BstMBI GATC 1 cut(s) 20
BstMWI GCNNNNNNNGC 2 cut(s) 242, 392
BstNSI RCATGY 2 cut(s) 245, 415
BstXI CCANNNNNNTGG 1 cut(s) 364
BtgI CCRYGG 1 cut(s) 431
BtrI CACGTC 1 cut(s) 143
BtsIMutI CAGTG 3 cut(s) 86, 127, 197
Cac8I GCNNGC 1 cut(s) 384
CaiI CAGNNNCTG 1 cut(s) 126
CfoI GCGC 1 cut(s) 395
CseI GACGC 1 cut(s) 242
CviAII CATG 3 cut(s) 242, 412, 432
CviJI RGCY 2 cut(s) 92, 386
CviKI_1 RGCY 2 cut(s) 92, 386
DdeI CTNAG 1 cut(s) 378
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
DraIII CACNNNGTG 1 cut(s) 107
Eco130I CCWWGG 1 cut(s) 431
EcoT14I CCWWGG 1 cut(s) 431
ErhI CCWWGG 1 cut(s) 431
FaeI CATG 3 cut(s) 245, 415, 435
FaiI YATR 8 cut(s) 51, 212, 243, 279, 329, 413, 417, 433
FatI CATG 3 cut(s) 241, 411, 431
FspBI CTAG 3 cut(s) 299, 314, 390
GlaI GCGC 1 cut(s) 394
HgaI GACGC 1 cut(s) 242
HhaI GCGC 1 cut(s) 395
Hin1II CATG 3 cut(s) 245, 415, 435
Hin6I GCGC 1 cut(s) 393
HinP1I GCGC 1 cut(s) 393
HincII GTYRAC 1 cut(s) 69
HindII GTYRAC 1 cut(s) 69
HinfI GANTC 2 cut(s) 8, 250
HphI GGTGA 1 cut(s) 93
Hpy166II GTNNAC 2 cut(s) 69, 367
Hpy188I TCNGA 2 cut(s) 306, 334
Hpy188III TCNNGA 4 cut(s) 131, 230, 292, 323
Hpy8I GTNNAC 2 cut(s) 69, 367
HpyAV CCTTC 2 cut(s) 156, 413
HpyCH4IV ACGT 1 cut(s) 142
HpyCH4V TGCA 2 cut(s) 281, 408
HpyF10VI GCNNNNNNNGC 2 cut(s) 242, 392
HpyF3I CTNAG 1 cut(s) 378
HpySE526I ACGT 1 cut(s) 142
Hsp92II CATG 3 cut(s) 245, 415, 435
HspAI GCGC 1 cut(s) 393
Kzo9I GATC 1 cut(s) 20
LmnI GCTCC 1 cut(s) 97
LpnPI CCDG 4 cut(s) 74, 129, 144, 247
MaeI CTAG 3 cut(s) 299, 314, 390
MaeII ACGT 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 230
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MluCI AATT 2 cut(s) 26, 213
MlyI GAGTC 1 cut(s) 259
MmeI TCCRAC 2 cut(s) 119, 404
MnlI CCTC 2 cut(s) 157, 205
MseI TTAA 1 cut(s) 216
MwoI GCNNNNNNNGC 2 cut(s) 242, 392
NcoI CCATGG 1 cut(s) 431
NdeII GATC 1 cut(s) 20
NlaIII CATG 3 cut(s) 245, 415, 435
NlaIV GGNNCC 1 cut(s) 93
NmuCI GTSAC 1 cut(s) 230
NspI RCATGY 2 cut(s) 245, 415
PciI ACATGT 1 cut(s) 411
PfeI GAWTC 1 cut(s) 8
PleI GAGTC 1 cut(s) 258
PpsI GAGTC 1 cut(s) 258
PscI ACATGT 1 cut(s) 411
PsiI TTATAA 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 93
PstNI CAGNNNCTG 1 cut(s) 126
SaqAI TTAA 1 cut(s) 216
Sau3AI GATC 1 cut(s) 20
SchI GAGTC 1 cut(s) 259
SetI ASST 6 cut(s) 118, 145, 168, 210, 379, 424
SmlI CTYRAG 1 cut(s) 292
SmoI CTYRAG 1 cut(s) 292
SpeI ACTAGT 1 cut(s) 298
Sse9I AATT 2 cut(s) 26, 213
SsiI CCGC 1 cut(s) 14
SspMI CTAG 3 cut(s) 299, 314, 390
StyI CCWWGG 1 cut(s) 431
TaiI ACGT 1 cut(s) 145
TaqI TCGA 2 cut(s) 248, 253
TasI AATT 2 cut(s) 26, 213
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TscAI CASTG 3 cut(s) 93, 127, 204
TseFI GTSAC 1 cut(s) 230
Tsp45I GTSAC 1 cut(s) 230
TspDTI ATGAA 6 cut(s) 93, 126, 201, 237, 323, 432
TspRI CASTG 3 cut(s) 93, 127, 204
XapI RAATTY 1 cut(s) 26
XceI RCATGY 2 cut(s) 245, 415
XspI CTAG 3 cut(s) 299, 314, 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.