Rmu_sc0001303.1_g000012

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001303.1
OG0001694
Physical Location & Seq
Forward (+)
61481 .. 62515
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001303.1_g000012.1.cds

Sequence Viewer

Length: 423 bp
atggtggtgtggtgttttggagaagaggagaggatggagaggtggtgtgcggctgctgatggttctagggtgcaaaagggagatggcacaacaaaatcggtgagaagaaaagctctggcaagtaggaaaaagtttccaagcacaagagtaaagagacaaaagcagaaaaaagtggaacaagacagggaagaagaggaggatgaagaagaggaggaagaagatgagaatgaacaagacaagggagaagaggacaatgaagtagaggaggaggaagaagaagagaacaatggatcaagaaacaaaggcaaagaccagaaacaatcatattgccaatacaagtgcaatatgattatgaatgcaacgagtgcagtagcaggattggacgagtgcagtagcaggattaggcaatatcgagtgcagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.43

Weight (kDa)

4.8

Isoelectric Point (pI)

83.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AclWI GGATC 1 cut(s) 298
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 148
AlwI GGATC 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 53
AsuHPI GGTGA 1 cut(s) 112
BbvI GCAGC 1 cut(s) 40
BccI CCATC 3 cut(s) 28, 53, 77
BcoDI GTCTC 1 cut(s) 148
BfaI CTAG 1 cut(s) 66
BisI GCNGC 2 cut(s) 51, 54
BlsI GCNGC 2 cut(s) 52, 55
BsaXI ACNNNNNCTCC 2 cut(s) 29, 59
BseGI GGATG 2 cut(s) 39, 205
BseRI GAGGAG 5 cut(s) 41, 209, 224, 278, 281
BseXI GCAGC 1 cut(s) 40
BsgI GTGCAG 2 cut(s) 387, 409
BsmAI GTCTC 1 cut(s) 148
BsmI GAATGC 1 cut(s) 361
Bsp143I GATC 1 cut(s) 290
BspACI CCGC 1 cut(s) 50
BspPI GGATC 1 cut(s) 298
BssMI GATC 1 cut(s) 290
Bst6I CTCTTC 5 cut(s) 18, 186, 201, 240, 273
BstAPI GCANNNNNTGC 1 cut(s) 365
BstF5I GGATG 2 cut(s) 39, 205
BstKTI GATC 1 cut(s) 293
BstMAI GTCTC 1 cut(s) 148
BstMBI GATC 1 cut(s) 290
BstMWI GCNNNNNNNGC 1 cut(s) 365
BstV1I GCAGC 1 cut(s) 40
BtsCI GGATG 2 cut(s) 39, 205
CviJI RGCY 2 cut(s) 53, 113
CviKI_1 RGCY 2 cut(s) 53, 113
DpnI GATC 1 cut(s) 292
DpnII GATC 1 cut(s) 290
Eam1104I CTCTTC 5 cut(s) 18, 186, 201, 240, 273
EarI CTCTTC 5 cut(s) 18, 186, 201, 240, 273
FaiI YATR 3 cut(s) 325, 347, 353
Fnu4HI GCNGC 2 cut(s) 51, 54
FokI GGATG 2 cut(s) 46, 212
Fsp4HI GCNGC 2 cut(s) 51, 54
FspBI CTAG 1 cut(s) 66
GluI GCNGC 2 cut(s) 51, 54
HphI GGTGA 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 294
HpyCH4V TGCA 6 cut(s) 73, 342, 359, 368, 390, 418
HpyF10VI GCNNNNNNNGC 1 cut(s) 365
Kzo9I GATC 1 cut(s) 290
LpnPI CCDG 5 cut(s) 101, 169, 326, 360, 382
Lsp1109I GCAGC 1 cut(s) 40
MaeI CTAG 1 cut(s) 66
MalI GATC 1 cut(s) 292
MboI GATC 1 cut(s) 290
Mva1269I GAATGC 1 cut(s) 361
MwoI GCNNNNNNNGC 1 cut(s) 365
NdeII GATC 1 cut(s) 290
PctI GAATGC 1 cut(s) 361
PkrI GCNGC 2 cut(s) 52, 55
SatI GCNGC 2 cut(s) 51, 54
Sau3AI GATC 1 cut(s) 290
SetI ASST 2 cut(s) 44, 115
SsiI CCGC 1 cut(s) 50
SspMI CTAG 1 cut(s) 66
TaqI TCGA 1 cut(s) 412
TauI GCSGC 1 cut(s) 53
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 4 cut(s) 216, 243, 270, 368
XspI CTAG 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.