Rmu_sc0002126.1_g000004

Belongs to the DEAD box helicase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002126.1
Physical Location & Seq
Forward (+)
11538 .. 12113
576 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002126.1_g000004.1.cds

Sequence Viewer

Length: 576 bp
atgccacctgaggccctggagatcacaaggaagtttatgaacaaacctgtgaggattcttgtgaagcgtgatgaactcaccctggaaggaattaagcagttttatgtcaatgtggacaaggaggagtggaagcttgacactttgtgtgatctttatgaaaccttggccattacccagagtgtgattttcgtgaatactcgacgcaaggttgattggttgaccgacaaaatgagaagccgggaccatacagtctctgcaacccatggagacatggaccagaacaacagagacatcatcatgagggaattccgttctgggtcatctcgtgtcttgatcaccaccgatctgttggctcgtggtattgatgtacaacaagtttcccttgttattaactatgatctgcctacccagcctgagaactacctccatagaattggtcgtagtggaagatttggtaggaagggagttgcaatcaactttgttacaaaggatgatgagagaatgctgtttgatatccagaagttctacaatgtggtagtagaggagctgccctcaaatgttgctgatctcctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

191

Amino Acids

22.26

Weight (kDa)

6.33

Isoelectric Point (pI)

41.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 248
AcoI YGGCCR 1 cut(s) 165
AcsI RAATTY 1 cut(s) 305
AdeI CACNNNGTG 1 cut(s) 144
AfaI GTAC 1 cut(s) 369
AjnI CCWGG 2 cut(s) 15, 81
AluBI AGCT 2 cut(s) 133, 547
AluI AGCT 2 cut(s) 133, 547
Alw26I GTCTC 3 cut(s) 256, 261, 282
AlwNI CAGNNNCTG 1 cut(s) 254
AoxI GGCC 2 cut(s) 12, 165
ApeKI GCWGC 1 cut(s) 547
ApoI RAATTY 1 cut(s) 305
AspS9I GGNCC 3 cut(s) 13, 241, 274
AsuC2I CCSGG 1 cut(s) 239
AsuHPI GGTGA 2 cut(s) 70, 328
AvaII GGWCC 2 cut(s) 241, 274
AxyI CCTNAGG 1 cut(s) 9
BalI TGGCCA 1 cut(s) 167
BauI CACGAG 2 cut(s) 324, 354
BbvI GCAGC 1 cut(s) 534
BciT130I CCWGG 2 cut(s) 17, 83
BclI TGATCA 1 cut(s) 333
BcnI CCSGG 1 cut(s) 239
BcoDI GTCTC 3 cut(s) 256, 261, 282
BisI GCNGC 1 cut(s) 548
BlsI GCNGC 1 cut(s) 549
Bme1390I CCNGG 3 cut(s) 17, 83, 239
Bme18I GGWCC 2 cut(s) 241, 274
BmgT120I GGNCC 3 cut(s) 13, 241, 274
BmiI GGNNCC 1 cut(s) 242
BmrFI CCNGG 3 cut(s) 17, 83, 239
BplI GAGNNNNNCTC 2 cut(s) 536, 568
BpmI CTGGAG 1 cut(s) 38
BpuMI CCSGG 1 cut(s) 239
BsaJI CCNNGG 4 cut(s) 15, 81, 162, 262
Bse21I CCTNAGG 1 cut(s) 9
BseBI CCWGG 2 cut(s) 17, 83
BseDI CCNNGG 4 cut(s) 15, 81, 162, 262
BseGI GGATG 1 cut(s) 496
BseMII CTCAG 1 cut(s) 405
BseRI GAGGAG 3 cut(s) 137, 557, 560
BseXI GCAGC 1 cut(s) 534
BseYI CCCAGC 1 cut(s) 408
BshFI GGCC 2 cut(s) 14, 167
BsiSI CCGG 1 cut(s) 238
BslFI GGGAC 1 cut(s) 254
BsmAI GTCTC 3 cut(s) 256, 261, 282
BsmFI GGGAC 1 cut(s) 254
BsmI GAATGC 1 cut(s) 507
BsnI GGCC 2 cut(s) 14, 167
Bsp1407I TGTACA 1 cut(s) 367
Bsp143I GATC 6 cut(s) 21, 148, 333, 343, 397, 565
Bsp19I CCATGG 1 cut(s) 262
BspANI GGCC 2 cut(s) 14, 167
BspCNI CTCAG 1 cut(s) 406
BspHI TCATGA 1 cut(s) 297
BspLI GGNNCC 1 cut(s) 242
BsrGI TGTACA 1 cut(s) 367
BssECI CCNNGG 4 cut(s) 15, 81, 162, 262
BssMI GATC 6 cut(s) 21, 148, 333, 343, 397, 565
BssSI CACGAG 2 cut(s) 324, 354
BssT1I CCWWGG 2 cut(s) 162, 262
Bst2BI CACGAG 2 cut(s) 324, 354
Bst2UI CCWGG 2 cut(s) 17, 83
Bst4CI ACNGT 1 cut(s) 250
BstAUI TGTACA 1 cut(s) 367
BstDEI CTNAG 2 cut(s) 9, 414
BstDSI CCRYGG 1 cut(s) 262
BstF5I GGATG 1 cut(s) 496
BstKTI GATC 6 cut(s) 24, 151, 336, 346, 400, 568
BstMAI GTCTC 3 cut(s) 256, 261, 282
BstMBI GATC 6 cut(s) 21, 148, 333, 343, 397, 565
BstMWI GCNNNNNNNGC 1 cut(s) 409
BstNI CCWGG 2 cut(s) 17, 83
BstSCI CCNGG 3 cut(s) 15, 81, 237
BstV1I GCAGC 1 cut(s) 534
BstXI CCANNNNNNTGG 1 cut(s) 434
Bsu36I CCTNAGG 1 cut(s) 9
BsuRI GGCC 2 cut(s) 14, 167
BtgI CCRYGG 1 cut(s) 262
BtsCI GGATG 1 cut(s) 496
CaiI CAGNNNCTG 1 cut(s) 254
CciI TCATGA 1 cut(s) 297
Cfr13I GGNCC 3 cut(s) 13, 241, 274
CseI GACGC 1 cut(s) 210
Csp6I GTAC 1 cut(s) 368
CviAII CATG 3 cut(s) 263, 271, 298
CviJI RGCY 7 cut(s) 14, 133, 167, 237, 353, 412, 547
CviKI_1 RGCY 7 cut(s) 14, 133, 167, 237, 353, 412, 547
CviQI GTAC 1 cut(s) 368
DdeI CTNAG 2 cut(s) 9, 414
DpnI GATC 6 cut(s) 23, 150, 335, 345, 399, 567
DpnII GATC 6 cut(s) 21, 148, 333, 343, 397, 565
DraIII CACNNNGTG 1 cut(s) 144
DrdI GACNNNNNNGTC 1 cut(s) 248
DseDI GACNNNNNNGTC 1 cut(s) 248
EaeI YGGCCR 1 cut(s) 165
Eco130I CCWWGG 2 cut(s) 162, 262
Eco32I GATATC 1 cut(s) 514
Eco47I GGWCC 2 cut(s) 241, 274
Eco81I CCTNAGG 1 cut(s) 9
EcoO109I RGGNCCY 1 cut(s) 13
EcoRI GAATTC 1 cut(s) 305
EcoRII CCWGG 2 cut(s) 15, 81
EcoRV GATATC 1 cut(s) 514
EcoT14I CCWWGG 2 cut(s) 162, 262
ErhI CCWWGG 2 cut(s) 162, 262
FaeI CATG 3 cut(s) 266, 274, 301
FaiI YATR 9 cut(s) 38, 105, 156, 246, 264, 272, 299, 396, 429
FalI AAGNNNNNCTT 2 cut(s) 366, 398
FaqI GGGAC 1 cut(s) 254
FatI CATG 3 cut(s) 262, 270, 297
FbaI TGATCA 1 cut(s) 333
Fnu4HI GCNGC 1 cut(s) 548
FokI GGATG 1 cut(s) 503
Fsp4HI GCNGC 1 cut(s) 548
GluI GCNGC 1 cut(s) 548
GsaI CCCAGC 1 cut(s) 412
GsuI CTGGAG 1 cut(s) 38
HaeIII GGCC 2 cut(s) 14, 167
HapII CCGG 1 cut(s) 238
HgaI GACGC 1 cut(s) 210
Hin1II CATG 3 cut(s) 266, 274, 301
HincII GTYRAC 1 cut(s) 219
HindII GTYRAC 1 cut(s) 219
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 1 cut(s) 55
HpaII CCGG 1 cut(s) 238
HphI GGTGA 2 cut(s) 70, 328
Hpy166II GTNNAC 2 cut(s) 115, 219
Hpy188I TCNGA 1 cut(s) 575
Hpy188III TCNNGA 4 cut(s) 190, 298, 331, 517
Hpy8I GTNNAC 2 cut(s) 115, 219
Hpy99I CGWCG 1 cut(s) 204
HpyAV CCTTC 2 cut(s) 80, 454
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4V TGCA 2 cut(s) 257, 470
HpyF10VI GCNNNNNNNGC 1 cut(s) 409
HpyF3I CTNAG 2 cut(s) 9, 414
Hsp92II CATG 3 cut(s) 266, 274, 301
Ksp22I TGATCA 1 cut(s) 333
Kzo9I GATC 6 cut(s) 21, 148, 333, 343, 397, 565
LmnI GCTCC 1 cut(s) 544
Lsp1109I GCAGC 1 cut(s) 534
MaeIII GTNAC 1 cut(s) 481
MalI GATC 6 cut(s) 23, 150, 335, 345, 399, 567
MboI GATC 6 cut(s) 21, 148, 333, 343, 397, 565
MboII GAAGA 1 cut(s) 459
MlsI TGGCCA 1 cut(s) 167
MluCI AATT 3 cut(s) 90, 305, 432
MluNI TGGCCA 1 cut(s) 167
MnlI CCTC 7 cut(s) 4, 45, 115, 294, 434, 535, 562
Mox20I TGGCCA 1 cut(s) 167
MscI TGGCCA 1 cut(s) 167
MseI TTAA 2 cut(s) 93, 390
MslI CAYNNNNRTG 1 cut(s) 296
Msp20I TGGCCA 1 cut(s) 167
MspI CCGG 1 cut(s) 238
MspR9I CCNGG 3 cut(s) 17, 83, 239
Mva1269I GAATGC 1 cut(s) 507
MvaI CCWGG 2 cut(s) 17, 83
MwoI GCNNNNNNNGC 1 cut(s) 409
NciI CCSGG 1 cut(s) 239
NcoI CCATGG 1 cut(s) 262
NdeII GATC 6 cut(s) 21, 148, 333, 343, 397, 565
NlaIII CATG 3 cut(s) 266, 274, 301
NlaIV GGNNCC 1 cut(s) 242
PagI TCATGA 1 cut(s) 297
PctI GAATGC 1 cut(s) 507
PfeI GAWTC 1 cut(s) 55
PkrI GCNGC 1 cut(s) 549
Psp6I CCWGG 2 cut(s) 15, 81
PspFI CCCAGC 1 cut(s) 408
PspGI CCWGG 2 cut(s) 15, 81
PspN4I GGNNCC 1 cut(s) 242
PspPI GGNCC 3 cut(s) 13, 241, 274
PstNI CAGNNNCTG 1 cut(s) 254
RsaI GTAC 1 cut(s) 369
RsaNI GTAC 1 cut(s) 368
RseI CAYNNNNRTG 1 cut(s) 296
SaqAI TTAA 2 cut(s) 93, 390
SatI GCNGC 1 cut(s) 548
Sau3AI GATC 6 cut(s) 21, 148, 333, 343, 397, 565
Sau96I GGNCC 3 cut(s) 13, 241, 274
ScrFI CCNGG 3 cut(s) 17, 83, 239
SetI ASST 7 cut(s) 10, 49, 135, 164, 210, 426, 549
SinI GGWCC 2 cut(s) 241, 274
SmiMI CAYNNNNRTG 1 cut(s) 296
Sse9I AATT 3 cut(s) 90, 305, 432
StyD4I CCNGG 3 cut(s) 15, 81, 237
StyI CCWWGG 2 cut(s) 162, 262
TaaI ACNGT 1 cut(s) 250
TaqI TCGA 1 cut(s) 199
TaqII GACCGA 1 cut(s) 236
TasI AATT 3 cut(s) 90, 305, 432
TatI WGTACW 1 cut(s) 367
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 2 cut(s) 93, 390
Tru9I TTAA 2 cut(s) 93, 390
TseI GCWGC 1 cut(s) 547
TspDTI ATGAA 3 cut(s) 53, 87, 171
TspGWI ACGGA 1 cut(s) 299
VpaK11BI GGWCC 2 cut(s) 241, 274
XapI RAATTY 1 cut(s) 305
XcmI CCANNNNNNNNNTGG 1 cut(s) 346
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.