Rmu_sc0020003.1_g000001

Belongs to the DEAD box helicase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020003.1
Physical Location & Seq
Forward (+)
1 .. 2354
2354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020003.1_g000001.1.cds

Sequence Viewer

Length: 760 bp
atcgatttcccctctccttctttttcactcttccaacaaatcaacatcatcgtccacagtcatggcggcacctgaaggttcacagtttgatacacgtcagttcgacaccaagatgaatgagttgcttgcaactgatggacaagatttctttacatcatacgatgaagtttacgacagttttgattccatgggcttgcaagagaacctgctgaggggcatttatgcttacggttttgagaaaccctctgctattcagcaaaggggaattgtcccctttattaagggtcttgatgtgattcagcaggctcaatctggaactgggaagacagcgaccttctgttctggtattcttcaacagcttgattatagtttgacggattgccagggcttggttctggcacccactcgagagcttgcccaacaaatagagaaggtcatgagggcccttggagattatcttggtgttaaggtgcatgcatgtgttggtggaactagtgttcgtgaagaccaacgtattctgtcaaatggagttcatgctgttgttggaactccaggtcgtgtttttgatatgctaagaagacagtcacttcgccctgatcatatcaagatgtttgttcttgatgaggctgatgaaatgctctctcggggtttcaaggaccaggtttgtttccaagacaatttcttcatattatttatgtgtttttatgatctacgagtatatcctgcagtatttcatatgcatgaaatgaaaagaatttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

252

Amino Acids

28.35

Weight (kDa)

5.51

Isoelectric Point (pI)

52.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 214
AccB1I GGYRCC 2 cut(s) 68, 398
AccB7I CCANNNNNTGG 1 cut(s) 389
AciI CCGC 1 cut(s) 66
AcsI RAATTY 1 cut(s) 754
AcuI CTGAAG 1 cut(s) 94
AfiI CCNNNNNNNGG 2 cut(s) 212, 389
AflIII ACRYGT 1 cut(s) 93
AgsI TTSAA 2 cut(s) 354, 653
AhlI ACTAGT 1 cut(s) 492
AjiI CACGTC 1 cut(s) 96
AjnI CCWGG 3 cut(s) 382, 551, 658
AloI GAACNNNNNNTCC 2 cut(s) 481, 513
AluBI AGCT 2 cut(s) 359, 413
AluI AGCT 2 cut(s) 359, 413
Ama87I CYCGRG 2 cut(s) 406, 643
AoxI GGCC 1 cut(s) 442
ApaI GGGCCC 1 cut(s) 446
ApoI RAATTY 1 cut(s) 754
ArsI GACNNNNNNTTYG 2 cut(s) 571, 603
AspS9I GGNCC 3 cut(s) 442, 443, 656
AvaI CYCGRG 2 cut(s) 406, 643
AvaII GGWCC 1 cut(s) 656
BaeGI GKGCMC 1 cut(s) 446
BanI GGYRCC 2 cut(s) 68, 398
BanII GRGCYC 1 cut(s) 446
BbsI GAAGAC 3 cut(s) 330, 511, 584
BbvCI CCTCAGC 1 cut(s) 210
BccI CCATC 1 cut(s) 129
BciT130I CCWGG 3 cut(s) 384, 553, 660
BclI TGATCA 1 cut(s) 596
BcuI ACTAGT 1 cut(s) 492
BfaI CTAG 1 cut(s) 493
BfmI CTRYAG 1 cut(s) 724
BfuAI ACCTGC 1 cut(s) 214
BisI GCNGC 1 cut(s) 67
BlsI GCNGC 1 cut(s) 68
Bme1390I CCNGG 3 cut(s) 384, 553, 660
Bme18I GGWCC 1 cut(s) 656
BmeT110I CYCGRG 2 cut(s) 406, 643
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 3 cut(s) 442, 443, 656
BmiI GGNNCC 3 cut(s) 70, 400, 444
BmrFI CCNGG 3 cut(s) 384, 553, 660
BmrI ACTGGG 1 cut(s) 328
BmuI ACTGGG 1 cut(s) 328
BpiI GAAGAC 3 cut(s) 330, 511, 584
BplI GAGNNNNNCTC 2 cut(s) 228, 260
BpmI CTGGAG 1 cut(s) 535
Bpu10I CCTNAGC 1 cut(s) 210
Bsa29I ATCGAT 1 cut(s) 3
BsaJI CCNNGG 3 cut(s) 187, 383, 446
Bsc4I CCNNNNNNNGG 2 cut(s) 212, 389
Bse1I ACTGG 1 cut(s) 323
BseBI CCWGG 3 cut(s) 384, 553, 660
BseCI ATCGAT 1 cut(s) 3
BseDI CCNNGG 3 cut(s) 187, 383, 446
BseLI CCNNNNNNNGG 2 cut(s) 212, 389
BseMII CTCAG 1 cut(s) 201
BseNI ACTGG 1 cut(s) 323
BseSI GKGCMC 1 cut(s) 446
BshFI GGCC 1 cut(s) 444
BshNI GGYRCC 2 cut(s) 68, 398
BshVI ATCGAT 1 cut(s) 3
BsiHKCI CYCGRG 2 cut(s) 406, 643
BslFI GGGAC 1 cut(s) 255
BslI CCNNNNNNNGG 2 cut(s) 212, 389
BsmFI GGGAC 1 cut(s) 255
BsnI GGCC 1 cut(s) 444
BsoBI CYCGRG 2 cut(s) 406, 643
Bsp120I GGGCCC 1 cut(s) 442
Bsp1286I GDGCHC 1 cut(s) 446
Bsp143I GATC 2 cut(s) 596, 707
Bsp19I CCATGG 1 cut(s) 187
BspACI CCGC 1 cut(s) 66
BspANI GGCC 1 cut(s) 444
BspCNI CTCAG 1 cut(s) 202
BspDI ATCGAT 1 cut(s) 3
BspHI TCATGA 1 cut(s) 436
BspLI GGNNCC 3 cut(s) 70, 400, 444
BspMAI CTGCAG 1 cut(s) 728
BspMI ACCTGC 1 cut(s) 214
BspT107I GGYRCC 2 cut(s) 68, 398
BsrI ACTGG 1 cut(s) 323
BssECI CCNNGG 3 cut(s) 187, 383, 446
BssMI GATC 2 cut(s) 596, 707
BssT1I CCWWGG 2 cut(s) 187, 446
Bst2UI CCWGG 3 cut(s) 384, 553, 660
Bst4CI ACNGT 5 cut(s) 59, 85, 177, 231, 583
Bst6I CTCTTC 1 cut(s) 35
BstC8I GCNNGC 5 cut(s) 127, 195, 304, 415, 475
BstDEI CTNAG 2 cut(s) 210, 573
BstDSI CCRYGG 1 cut(s) 187
BstKTI GATC 2 cut(s) 599, 710
BstMBI GATC 2 cut(s) 596, 707
BstNI CCWGG 3 cut(s) 384, 553, 660
BstNSI RCATGY 2 cut(s) 477, 481
BstSCI CCNGG 3 cut(s) 382, 551, 658
BstSFI CTRYAG 1 cut(s) 724
BstSLI GKGCMC 1 cut(s) 446
BstV2I GAAGAC 3 cut(s) 330, 511, 584
BstXI CCANNNNNNTGG 1 cut(s) 62
Bsu15I ATCGAT 1 cut(s) 3
BsuRI GGCC 1 cut(s) 444
BsuTUI ATCGAT 1 cut(s) 3
BtgI CCRYGG 1 cut(s) 187
BtrI CACGTC 1 cut(s) 96
BveI ACCTGC 1 cut(s) 214
Cac8I GCNNGC 5 cut(s) 127, 195, 304, 415, 475
CciI TCATGA 1 cut(s) 436
Cfr13I GGNCC 3 cut(s) 442, 443, 656
ClaI ATCGAT 1 cut(s) 3
CsiI ACCWGGT 1 cut(s) 658
CviAII CATG 7 cut(s) 62, 188, 437, 474, 478, 534, 741
CviJI RGCY 7 cut(s) 193, 306, 359, 388, 413, 444, 627
CviKI_1 RGCY 7 cut(s) 193, 306, 359, 388, 413, 444, 627
DdeI CTNAG 2 cut(s) 210, 573
DpnI GATC 2 cut(s) 598, 709
DpnII GATC 2 cut(s) 596, 707
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco130I CCWWGG 2 cut(s) 187, 446
Eco24I GRGCYC 1 cut(s) 446
Eco47I GGWCC 1 cut(s) 656
Eco57I CTGAAG 1 cut(s) 94
Eco88I CYCGRG 2 cut(s) 406, 643
EcoO109I RGGNCCY 2 cut(s) 442, 443
EcoRII CCWGG 3 cut(s) 382, 551, 658
EcoT14I CCWWGG 2 cut(s) 187, 446
EcoT22I ATGCAT 2 cut(s) 479, 742
EcoT38I GRGCYC 1 cut(s) 446
ErhI CCWWGG 2 cut(s) 187, 446
FaeI CATG 7 cut(s) 65, 191, 440, 477, 481, 537, 744
FaqI GGGAC 1 cut(s) 255
FatI CATG 7 cut(s) 61, 187, 436, 473, 477, 533, 740
FauNDI CATATG 1 cut(s) 736
FbaI TGATCA 1 cut(s) 596
Fnu4HI GCNGC 1 cut(s) 67
FriOI GRGCYC 1 cut(s) 446
Fsp4HI GCNGC 1 cut(s) 67
FspBI CTAG 1 cut(s) 493
GluI GCNGC 1 cut(s) 67
GsuI CTGGAG 1 cut(s) 535
HaeIII GGCC 1 cut(s) 444
Hin1II CATG 7 cut(s) 65, 191, 440, 477, 481, 537, 744
HinfI GANTC 2 cut(s) 183, 296
Hpy166II GTNNAC 3 cut(s) 55, 81, 170
Hpy188III TCNNGA 7 cut(s) 288, 313, 408, 437, 501, 605, 618
Hpy8I GTNNAC 3 cut(s) 55, 81, 170
HpyAV CCTTC 4 cut(s) 27, 69, 344, 425
HpyCH4III ACNGT 5 cut(s) 59, 85, 177, 231, 583
HpyCH4IV ACGT 2 cut(s) 95, 512
HpyCH4V TGCA 6 cut(s) 129, 197, 473, 477, 726, 740
HpyF3I CTNAG 2 cut(s) 210, 573
HpySE526I ACGT 2 cut(s) 95, 512
Hsp92II CATG 7 cut(s) 65, 191, 440, 477, 481, 537, 744
Ksp22I TGATCA 1 cut(s) 596
Kzo9I GATC 2 cut(s) 596, 707
MabI ACCWGGT 1 cut(s) 658
MaeI CTAG 1 cut(s) 493
MaeII ACGT 2 cut(s) 95, 512
MaeIII GTNAC 1 cut(s) 583
MalI GATC 2 cut(s) 598, 709
MboI GATC 2 cut(s) 596, 707
MboII GAAGA 6 cut(s) 22, 335, 342, 516, 589, 674
MhlI GDGCHC 1 cut(s) 446
MluCI AATT 3 cut(s) 265, 677, 754
MmeI TCCRAC 2 cut(s) 58, 524
MnlI CCTC 5 cut(s) 22, 205, 254, 433, 617
Mph1103I ATGCAT 2 cut(s) 479, 742
MseI TTAA 3 cut(s) 280, 466, 758
MslI CAYNNNNRTG 4 cut(s) 60, 111, 478, 739
MspR9I CCNGG 3 cut(s) 384, 553, 660
MvaI CCWGG 3 cut(s) 384, 553, 660
NcoI CCATGG 1 cut(s) 187
NdeI CATATG 1 cut(s) 736
NdeII GATC 2 cut(s) 596, 707
NlaIII CATG 7 cut(s) 65, 191, 440, 477, 481, 537, 744
NlaIV GGNNCC 3 cut(s) 70, 400, 444
NmuCI GTSAC 1 cut(s) 583
NsiI ATGCAT 2 cut(s) 479, 742
NspI RCATGY 2 cut(s) 477, 481
PaeI GCATGC 1 cut(s) 477
PaeR7I CTCGAG 1 cut(s) 406
PagI TCATGA 1 cut(s) 436
PfeI GAWTC 2 cut(s) 183, 296
PflMI CCANNNNNTGG 1 cut(s) 389
PkrI GCNGC 1 cut(s) 68
Psp6I CCWGG 3 cut(s) 382, 551, 658
PspGI CCWGG 3 cut(s) 382, 551, 658
PspN4I GGNNCC 3 cut(s) 70, 400, 444
PspOMI GGGCCC 1 cut(s) 442
PspPI GGNCC 3 cut(s) 442, 443, 656
PstI CTGCAG 1 cut(s) 728
RseI CAYNNNNRTG 4 cut(s) 60, 111, 478, 739
SaqAI TTAA 3 cut(s) 280, 466, 758
SatI GCNGC 1 cut(s) 67
Sau3AI GATC 2 cut(s) 596, 707
Sau96I GGNCC 3 cut(s) 442, 443, 656
ScrFI CCNGG 3 cut(s) 384, 553, 660
SduI GDGCHC 1 cut(s) 446
SexAI ACCWGGT 1 cut(s) 658
SfcI CTRYAG 1 cut(s) 724
Sfr274I CTCGAG 1 cut(s) 406
SinI GGWCC 1 cut(s) 656
SlaI CTCGAG 1 cut(s) 406
SmiMI CAYNNNNRTG 4 cut(s) 60, 111, 478, 739
SmlI CTYRAG 1 cut(s) 406
SmoI CTYRAG 1 cut(s) 406
SpeI ACTAGT 1 cut(s) 492
SphI GCATGC 1 cut(s) 477
Sse9I AATT 3 cut(s) 265, 677, 754
SsiI CCGC 1 cut(s) 66
SspMI CTAG 1 cut(s) 493
StyD4I CCNGG 3 cut(s) 382, 551, 658
StyI CCWWGG 2 cut(s) 187, 446
TaaI ACNGT 5 cut(s) 59, 85, 177, 231, 583
TaiI ACGT 2 cut(s) 98, 515
TaqI TCGA 3 cut(s) 3, 103, 407
TasI AATT 3 cut(s) 265, 677, 754
TauI GCSGC 1 cut(s) 69
TfiI GAWTC 2 cut(s) 183, 296
Tru1I TTAA 3 cut(s) 280, 466, 758
Tru9I TTAA 3 cut(s) 280, 466, 758
TseFI GTSAC 1 cut(s) 583
Tsp45I GTSAC 1 cut(s) 583
TspDTI ATGAA 7 cut(s) 129, 178, 522, 646, 674, 723, 757
TspGWI ACGGA 1 cut(s) 390
Van91I CCANNNNNTGG 1 cut(s) 389
VpaK11BI GGWCC 1 cut(s) 656
XapI RAATTY 1 cut(s) 754
XceI RCATGY 2 cut(s) 477, 481
XhoI CTCGAG 1 cut(s) 406
XspI CTAG 1 cut(s) 493
Zsp2I ATGCAT 2 cut(s) 479, 742
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.