Rmu_sc0012116.1_g000001

Belongs to the DEAD box helicase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012116.1
OG0000799
Physical Location & Seq
Forward (+)
1 .. 3516
3516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012116.1_g000001.1.cds

Sequence Viewer

Length: 1297 bp
atcgatttcccctctccttctttttcactcttccaacaaatcaacatcatcgtccacagtcatggcggcacctgaaggttcacagtttgatacacgtcagttcgacactaagatgaatgagttgcttgcaactgatggacaagatttctttacatcatacgatgaagtttacgacagttttgattccatgggcttgcaagagaacctgctgaggggcatttatgcttacggttttgagaaaccctctgctattcagcaaaggggaattgtcccctttattaagggtcttgatgtgattcagcaggctcaatctggaactgggaagacagcgaccttctgttctggtattcttcaacagcttgattatagtttgacggattgccagggcttggttctggcacccactcgagagcttgcccaacaaatagagaaggtcatgagggcccttggagattatcttggtgttaaggtgcatgcatgtgttggaggaactagtgttcgtgaagaccaacgtattctgtcaaatggagttcatgctgttgttggaactccaggtcgtgtttttgatatgctaagaagacagtcacttcgccctgatcatatcaagatgtttgttcttgatgaggctgatgaaatgctctctcggggtttcaaggaccagatctatgatatattccagcttctcccaccaaagattcaggttggtgtgttttctgccaccatgccacctgaggccctggagatcacaaggaagtttatgaacaaacctgtgaggattcttgtgaagcgtgatgaactcaccctggaaggaattaagcagttttatgtcaatgtggacaaggaggagtggaagcttgacactttgtgtgatctttatgaaaccttggccattacccagagtgtgattttcgtgaatactcgacgcaaggttgattggttgaccgacaaaatgagaagccgggaccatacagtctctgcaacccatggagacatggaccagaacaacagagacatcatcatgagggaattccgttctgggtcatctcgtgtcttgatcaccaccgatctgttggctcgtggtattgatgtacaacaagtttcccttgttattaactatgatctgcctacccagcctgagaactacctccatagaattggtcgtagtggaagatttggtaggaagggagttgcaatcaactttgttacaaaggatgatgagagaatgctgtttgatatccagaagttctacaatgtggtagtagaggagctgccctcaaatgttgctgatctcctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
DEAD Helicase_C WD40

Protein Analysis

431

Amino Acids

48.78

Weight (kDa)

5.64

Isoelectric Point (pI)

44.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 969
Acc36I ACCTGC 1 cut(s) 214
AccB1I GGYRCC 2 cut(s) 68, 398
AccB7I CCANNNNNTGG 1 cut(s) 389
AciI CCGC 1 cut(s) 66
AcoI YGGCCR 1 cut(s) 886
AcsI RAATTY 1 cut(s) 1026
AcuI CTGAAG 1 cut(s) 94
AdeI CACNNNGTG 1 cut(s) 865
AfaI GTAC 1 cut(s) 1090
AfiI CCNNNNNNNGG 2 cut(s) 212, 389
AflIII ACRYGT 1 cut(s) 93
AgsI TTSAA 2 cut(s) 354, 653
AhlI ACTAGT 1 cut(s) 492
AjiI CACGTC 1 cut(s) 96
AjnI CCWGG 4 cut(s) 382, 551, 736, 802
AloI GAACNNNNNNTCC 2 cut(s) 481, 513
AluBI AGCT 5 cut(s) 359, 413, 680, 854, 1268
AluI AGCT 5 cut(s) 359, 413, 680, 854, 1268
Alw26I GTCTC 3 cut(s) 977, 982, 1003
AlwNI CAGNNNCTG 1 cut(s) 975
Ama87I CYCGRG 2 cut(s) 406, 643
AoxI GGCC 3 cut(s) 442, 733, 886
ApaI GGGCCC 1 cut(s) 446
ApeKI GCWGC 1 cut(s) 1268
ApoI RAATTY 1 cut(s) 1026
ArsI GACNNNNNNTTYG 2 cut(s) 571, 603
AspS9I GGNCC 6 cut(s) 442, 443, 656, 734, 962, 995
AsuC2I CCSGG 1 cut(s) 960
AsuHPI GGTGA 2 cut(s) 791, 1049
AvaI CYCGRG 2 cut(s) 406, 643
AvaII GGWCC 3 cut(s) 656, 962, 995
AxyI CCTNAGG 1 cut(s) 730
BaeGI GKGCMC 1 cut(s) 446
BalI TGGCCA 1 cut(s) 888
BanI GGYRCC 2 cut(s) 68, 398
BanII GRGCYC 1 cut(s) 446
BauI CACGAG 2 cut(s) 1045, 1075
BbsI GAAGAC 3 cut(s) 330, 511, 584
BbvCI CCTCAGC 1 cut(s) 210
BbvI GCAGC 1 cut(s) 1255
BccI CCATC 1 cut(s) 129
BciT130I CCWGG 4 cut(s) 384, 553, 738, 804
BclI TGATCA 2 cut(s) 596, 1054
BcnI CCSGG 1 cut(s) 960
BcoDI GTCTC 3 cut(s) 977, 982, 1003
BcuI ACTAGT 1 cut(s) 492
BfaI CTAG 1 cut(s) 493
BfuAI ACCTGC 1 cut(s) 214
BglII AGATCT 1 cut(s) 661
BisI GCNGC 2 cut(s) 67, 1269
BlsI GCNGC 2 cut(s) 68, 1270
Bme1390I CCNGG 5 cut(s) 384, 553, 738, 804, 960
Bme18I GGWCC 3 cut(s) 656, 962, 995
BmeT110I CYCGRG 2 cut(s) 406, 643
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 6 cut(s) 442, 443, 656, 734, 962, 995
BmiI GGNNCC 4 cut(s) 70, 400, 444, 963
BmrFI CCNGG 5 cut(s) 384, 553, 738, 804, 960
BmrI ACTGGG 1 cut(s) 328
BmuI ACTGGG 1 cut(s) 328
BpiI GAAGAC 3 cut(s) 330, 511, 584
BplI GAGNNNNNCTC 4 cut(s) 228, 260, 1257, 1289
BpmI CTGGAG 2 cut(s) 535, 759
Bpu10I CCTNAGC 1 cut(s) 210
BpuMI CCSGG 1 cut(s) 960
Bsa29I ATCGAT 1 cut(s) 3
BsaJI CCNNGG 7 cut(s) 187, 383, 446, 736, 802, 883, 983
Bsc4I CCNNNNNNNGG 2 cut(s) 212, 389
Bse1I ACTGG 1 cut(s) 323
Bse21I CCTNAGG 1 cut(s) 730
BseBI CCWGG 4 cut(s) 384, 553, 738, 804
BseCI ATCGAT 1 cut(s) 3
BseDI CCNNGG 7 cut(s) 187, 383, 446, 736, 802, 883, 983
BseGI GGATG 1 cut(s) 1217
BseLI CCNNNNNNNGG 2 cut(s) 212, 389
BseMII CTCAG 3 cut(s) 201, 721, 1126
BseNI ACTGG 1 cut(s) 323
BseRI GAGGAG 3 cut(s) 858, 1278, 1281
BseSI GKGCMC 1 cut(s) 446
BseXI GCAGC 1 cut(s) 1255
BseYI CCCAGC 1 cut(s) 1129
BshFI GGCC 3 cut(s) 444, 735, 888
BshNI GGYRCC 2 cut(s) 68, 398
BshVI ATCGAT 1 cut(s) 3
BsiHKCI CYCGRG 2 cut(s) 406, 643
BsiSI CCGG 1 cut(s) 959
BslFI GGGAC 2 cut(s) 255, 975
BslI CCNNNNNNNGG 2 cut(s) 212, 389
BsmAI GTCTC 3 cut(s) 977, 982, 1003
BsmFI GGGAC 2 cut(s) 255, 975
BsmI GAATGC 1 cut(s) 1228
BsnI GGCC 3 cut(s) 444, 735, 888
BsoBI CYCGRG 2 cut(s) 406, 643
Bsp120I GGGCCC 1 cut(s) 442
Bsp1286I GDGCHC 1 cut(s) 446
Bsp1407I TGTACA 1 cut(s) 1088
Bsp143I GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
Bsp19I CCATGG 2 cut(s) 187, 983
BspACI CCGC 1 cut(s) 66
BspANI GGCC 3 cut(s) 444, 735, 888
BspCNI CTCAG 3 cut(s) 202, 722, 1127
BspDI ATCGAT 1 cut(s) 3
BspHI TCATGA 2 cut(s) 436, 1018
BspLI GGNNCC 4 cut(s) 70, 400, 444, 963
BspMI ACCTGC 1 cut(s) 214
BspT107I GGYRCC 2 cut(s) 68, 398
BsrGI TGTACA 1 cut(s) 1088
BsrI ACTGG 1 cut(s) 323
BssECI CCNNGG 7 cut(s) 187, 383, 446, 736, 802, 883, 983
BssMI GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
BssSI CACGAG 2 cut(s) 1045, 1075
BssT1I CCWWGG 4 cut(s) 187, 446, 883, 983
Bst2BI CACGAG 2 cut(s) 1045, 1075
Bst2UI CCWGG 4 cut(s) 384, 553, 738, 804
Bst4CI ACNGT 6 cut(s) 59, 85, 177, 231, 583, 971
Bst6I CTCTTC 1 cut(s) 35
BstAUI TGTACA 1 cut(s) 1088
BstC8I GCNNGC 5 cut(s) 127, 195, 304, 415, 475
BstDEI CTNAG 5 cut(s) 109, 210, 573, 730, 1135
BstDSI CCRYGG 2 cut(s) 187, 983
BstF5I GGATG 1 cut(s) 1217
BstKTI GATC 8 cut(s) 599, 664, 745, 872, 1057, 1067, 1121, 1289
BstMAI GTCTC 3 cut(s) 977, 982, 1003
BstMBI GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
BstMWI GCNNNNNNNGC 1 cut(s) 1130
BstNI CCWGG 4 cut(s) 384, 553, 738, 804
BstNSI RCATGY 2 cut(s) 477, 481
BstSCI CCNGG 5 cut(s) 382, 551, 736, 802, 958
BstSLI GKGCMC 1 cut(s) 446
BstV1I GCAGC 1 cut(s) 1255
BstV2I GAAGAC 3 cut(s) 330, 511, 584
BstX2I RGATCY 1 cut(s) 661
BstXI CCANNNNNNTGG 2 cut(s) 62, 1155
BstYI RGATCY 1 cut(s) 661
Bsu15I ATCGAT 1 cut(s) 3
Bsu36I CCTNAGG 1 cut(s) 730
BsuRI GGCC 3 cut(s) 444, 735, 888
BsuTUI ATCGAT 1 cut(s) 3
BtgI CCRYGG 2 cut(s) 187, 983
BtrI CACGTC 1 cut(s) 96
BtsCI GGATG 1 cut(s) 1217
BveI ACCTGC 1 cut(s) 214
Cac8I GCNNGC 5 cut(s) 127, 195, 304, 415, 475
CaiI CAGNNNCTG 1 cut(s) 975
CciI TCATGA 2 cut(s) 436, 1018
Cfr13I GGNCC 6 cut(s) 442, 443, 656, 734, 962, 995
ClaI ATCGAT 1 cut(s) 3
CseI GACGC 1 cut(s) 931
Csp6I GTAC 1 cut(s) 1089
CviQI GTAC 1 cut(s) 1089
DdeI CTNAG 5 cut(s) 109, 210, 573, 730, 1135
DpnI GATC 8 cut(s) 598, 663, 744, 871, 1056, 1066, 1120, 1288
DpnII GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
DraIII CACNNNGTG 1 cut(s) 865
DrdI GACNNNNNNGTC 1 cut(s) 969
DseDI GACNNNNNNGTC 1 cut(s) 969
EaeI YGGCCR 1 cut(s) 886
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco130I CCWWGG 4 cut(s) 187, 446, 883, 983
Eco24I GRGCYC 1 cut(s) 446
Eco32I GATATC 1 cut(s) 1235
Eco47I GGWCC 3 cut(s) 656, 962, 995
Eco57I CTGAAG 1 cut(s) 94
Eco81I CCTNAGG 1 cut(s) 730
Eco88I CYCGRG 2 cut(s) 406, 643
EcoO109I RGGNCCY 3 cut(s) 442, 443, 734
EcoRI GAATTC 1 cut(s) 1026
EcoRII CCWGG 4 cut(s) 382, 551, 736, 802
EcoRV GATATC 1 cut(s) 1235
EcoT14I CCWWGG 4 cut(s) 187, 446, 883, 983
EcoT22I ATGCAT 1 cut(s) 479
EcoT38I GRGCYC 1 cut(s) 446
ErhI CCWWGG 4 cut(s) 187, 446, 883, 983
FalI AAGNNNNNCTT 2 cut(s) 1087, 1119
FaqI GGGAC 2 cut(s) 255, 975
FbaI TGATCA 2 cut(s) 596, 1054
Fnu4HI GCNGC 2 cut(s) 67, 1269
FokI GGATG 1 cut(s) 1224
FriOI GRGCYC 1 cut(s) 446
Fsp4HI GCNGC 2 cut(s) 67, 1269
FspBI CTAG 1 cut(s) 493
GluI GCNGC 2 cut(s) 67, 1269
GsaI CCCAGC 1 cut(s) 1133
GsuI CTGGAG 2 cut(s) 535, 759
HaeIII GGCC 3 cut(s) 444, 735, 888
HapII CCGG 1 cut(s) 959
HgaI GACGC 1 cut(s) 931
HincII GTYRAC 1 cut(s) 940
HindII GTYRAC 1 cut(s) 940
HindIII AAGCTT 1 cut(s) 852
HinfI GANTC 4 cut(s) 183, 296, 695, 776
HpaII CCGG 1 cut(s) 959
HphI GGTGA 2 cut(s) 791, 1049
Hpy166II GTNNAC 5 cut(s) 55, 81, 170, 836, 940
Hpy188I TCNGA 1 cut(s) 1296
Hpy8I GTNNAC 5 cut(s) 55, 81, 170, 836, 940
Hpy99I CGWCG 1 cut(s) 925
HpyAV CCTTC 6 cut(s) 27, 69, 344, 425, 801, 1175
HpyCH4III ACNGT 6 cut(s) 59, 85, 177, 231, 583, 971
HpyCH4IV ACGT 2 cut(s) 95, 512
HpyCH4V TGCA 6 cut(s) 129, 197, 473, 477, 978, 1191
HpyF10VI GCNNNNNNNGC 1 cut(s) 1130
HpyF3I CTNAG 5 cut(s) 109, 210, 573, 730, 1135
HpySE526I ACGT 2 cut(s) 95, 512
Ksp22I TGATCA 2 cut(s) 596, 1054
Kzo9I GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
LmnI GCTCC 1 cut(s) 1265
Lsp1109I GCAGC 1 cut(s) 1255
MaeI CTAG 1 cut(s) 493
MaeII ACGT 2 cut(s) 95, 512
MaeIII GTNAC 2 cut(s) 583, 1202
MalI GATC 8 cut(s) 598, 663, 744, 871, 1056, 1066, 1120, 1288
MboI GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
MboII GAAGA 6 cut(s) 22, 335, 342, 516, 589, 1180
MflI RGATCY 1 cut(s) 661
MhlI GDGCHC 1 cut(s) 446
MlsI TGGCCA 1 cut(s) 888
MluCI AATT 4 cut(s) 265, 811, 1026, 1153
MluNI TGGCCA 1 cut(s) 888
MmeI TCCRAC 3 cut(s) 58, 464, 524
Mox20I TGGCCA 1 cut(s) 888
Mph1103I ATGCAT 1 cut(s) 479
MscI TGGCCA 1 cut(s) 888
MseI TTAA 4 cut(s) 280, 466, 814, 1111
MslI CAYNNNNRTG 4 cut(s) 60, 111, 478, 1017
Msp20I TGGCCA 1 cut(s) 888
MspI CCGG 1 cut(s) 959
MspR9I CCNGG 5 cut(s) 384, 553, 738, 804, 960
Mva1269I GAATGC 1 cut(s) 1228
MvaI CCWGG 4 cut(s) 384, 553, 738, 804
MwoI GCNNNNNNNGC 1 cut(s) 1130
NciI CCSGG 1 cut(s) 960
NcoI CCATGG 2 cut(s) 187, 983
NdeII GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
NlaIV GGNNCC 4 cut(s) 70, 400, 444, 963
NmuCI GTSAC 1 cut(s) 583
NsiI ATGCAT 1 cut(s) 479
NspI RCATGY 2 cut(s) 477, 481
PaeI GCATGC 1 cut(s) 477
PaeR7I CTCGAG 1 cut(s) 406
PagI TCATGA 2 cut(s) 436, 1018
PctI GAATGC 1 cut(s) 1228
PfeI GAWTC 4 cut(s) 183, 296, 695, 776
PflMI CCANNNNNTGG 1 cut(s) 389
PkrI GCNGC 2 cut(s) 68, 1270
Psp6I CCWGG 4 cut(s) 382, 551, 736, 802
PspFI CCCAGC 1 cut(s) 1129
PspGI CCWGG 4 cut(s) 382, 551, 736, 802
PspN4I GGNNCC 4 cut(s) 70, 400, 444, 963
PspOMI GGGCCC 1 cut(s) 442
PspPI GGNCC 6 cut(s) 442, 443, 656, 734, 962, 995
PstNI CAGNNNCTG 1 cut(s) 975
PsuI RGATCY 1 cut(s) 661
RsaI GTAC 1 cut(s) 1090
RsaNI GTAC 1 cut(s) 1089
RseI CAYNNNNRTG 4 cut(s) 60, 111, 478, 1017
SaqAI TTAA 4 cut(s) 280, 466, 814, 1111
SatI GCNGC 2 cut(s) 67, 1269
Sau3AI GATC 8 cut(s) 596, 661, 742, 869, 1054, 1064, 1118, 1286
Sau96I GGNCC 6 cut(s) 442, 443, 656, 734, 962, 995
ScrFI CCNGG 5 cut(s) 384, 553, 738, 804, 960
SduI GDGCHC 1 cut(s) 446
Sfr274I CTCGAG 1 cut(s) 406
SinI GGWCC 3 cut(s) 656, 962, 995
SlaI CTCGAG 1 cut(s) 406
SmiMI CAYNNNNRTG 4 cut(s) 60, 111, 478, 1017
SmlI CTYRAG 1 cut(s) 406
SmoI CTYRAG 1 cut(s) 406
SpeI ACTAGT 1 cut(s) 492
SphI GCATGC 1 cut(s) 477
Sse9I AATT 4 cut(s) 265, 811, 1026, 1153
SsiI CCGC 1 cut(s) 66
SspMI CTAG 1 cut(s) 493
StyD4I CCNGG 5 cut(s) 382, 551, 736, 802, 958
StyI CCWWGG 4 cut(s) 187, 446, 883, 983
TaaI ACNGT 6 cut(s) 59, 85, 177, 231, 583, 971
TaiI ACGT 2 cut(s) 98, 515
TaqI TCGA 4 cut(s) 3, 103, 407, 920
TaqII GACCGA 1 cut(s) 957
TasI AATT 4 cut(s) 265, 811, 1026, 1153
TatI WGTACW 1 cut(s) 1088
TauI GCSGC 1 cut(s) 69
TfiI GAWTC 4 cut(s) 183, 296, 695, 776
Tru1I TTAA 4 cut(s) 280, 466, 814, 1111
Tru9I TTAA 4 cut(s) 280, 466, 814, 1111
TseFI GTSAC 1 cut(s) 583
TseI GCWGC 1 cut(s) 1268
Tsp45I GTSAC 1 cut(s) 583
TspDTI ATGAA 7 cut(s) 129, 178, 522, 646, 774, 808, 892
TspGWI ACGGA 2 cut(s) 390, 1020
Van91I CCANNNNNTGG 1 cut(s) 389
VpaK11BI GGWCC 3 cut(s) 656, 962, 995
XapI RAATTY 1 cut(s) 1026
XceI RCATGY 2 cut(s) 477, 481
XcmI CCANNNNNNNNNTGG 1 cut(s) 1067
XhoI CTCGAG 1 cut(s) 406
XspI CTAG 1 cut(s) 493
Zsp2I ATGCAT 1 cut(s) 479
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.