Rmu_sc0002187.1_g000054

1-acyl-sn-glycerol-3-phosphate acyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002187.1
Physical Location & Seq
Reverse (-)
238311 .. 238619
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002187.1_g000054.1.cds

Sequence Viewer

Length: 219 bp
atggcgattgcacttggaattctctttgcaatggtcgtggtcctttatccgctaatccttcatctcattccggtggtactgctctgcgtctcaggcctctttgccaatctggttcaggcgttttgctttgtttttatctggccgatctcaaagaatgcatacacaaggataaacggcgtggttaaagaattggattggctggttctgcttgctcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.02

Weight (kDa)

7.84

Isoelectric Point (pI)

15.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AcoI YGGCCR 1 cut(s) 140
AcsI RAATTY 1 cut(s) 18
AfaI GTAC 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 94
AoxI GGCC 2 cut(s) 94, 140
ApoI RAATTY 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 40
AvaII GGWCC 1 cut(s) 40
BceAI ACGGC 1 cut(s) 190
BcoDI GTCTC 1 cut(s) 94
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BsaWI WCCGGW 1 cut(s) 70
Bse3DI GCAATG 1 cut(s) 36
BseMI GCAATG 1 cut(s) 36
BseMII CTCAG 1 cut(s) 105
BshFI GGCC 2 cut(s) 96, 142
BsiSI CCGG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 94
BsmBI CGTCTC 1 cut(s) 94
BsmI GAATGC 1 cut(s) 160
BsnI GGCC 2 cut(s) 96, 142
Bsp143I GATC 1 cut(s) 144
BspACI CCGC 1 cut(s) 50
BspANI GGCC 2 cut(s) 96, 142
BspCNI CTCAG 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 36
BssMI GATC 1 cut(s) 144
BstC8I GCNNGC 1 cut(s) 210
BstDEI CTNAG 1 cut(s) 91
BstKTI GATC 1 cut(s) 147
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 144
BstMWI GCNNNNNNNGC 2 cut(s) 93, 205
BsuRI GGCC 2 cut(s) 96, 142
Cac8I GCNNGC 1 cut(s) 210
Cfr13I GGNCC 1 cut(s) 40
CseI GACGC 1 cut(s) 76
Csp6I GTAC 1 cut(s) 77
CspCI CAANNNNNGTGG 2 cut(s) 18, 53
CviJI RGCY 3 cut(s) 96, 142, 199
CviKI_1 RGCY 3 cut(s) 96, 142, 199
CviQI GTAC 1 cut(s) 77
DdeI CTNAG 1 cut(s) 91
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
EaeI YGGCCR 1 cut(s) 140
Eco147I AGGCCT 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 40
EcoRI GAATTC 1 cut(s) 18
EcoT22I ATGCAT 1 cut(s) 160
Esp3I CGTCTC 1 cut(s) 94
FaiI YATR 1 cut(s) 160
HaeIII GGCC 2 cut(s) 96, 142
HapII CCGG 1 cut(s) 71
HgaI GACGC 1 cut(s) 76
HpaII CCGG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 68
HpyCH4V TGCA 3 cut(s) 11, 29, 158
HpyF10VI GCNNNNNNNGC 2 cut(s) 93, 205
HpyF3I CTNAG 1 cut(s) 91
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 6 cut(s) 78, 84, 95, 101, 124, 185
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MluCI AATT 2 cut(s) 18, 188
MnlI CCTC 1 cut(s) 107
Mph1103I ATGCAT 1 cut(s) 160
MseI TTAA 1 cut(s) 183
MslI CAYNNNNRTG 1 cut(s) 71
MspI CCGG 1 cut(s) 71
Mva1269I GAATGC 1 cut(s) 160
MwoI GCNNNNNNNGC 2 cut(s) 93, 205
NdeII GATC 1 cut(s) 144
NsiI ATGCAT 1 cut(s) 160
PceI AGGCCT 1 cut(s) 96
PctI GAATGC 1 cut(s) 160
PspPI GGNCC 1 cut(s) 40
RsaI GTAC 1 cut(s) 78
RsaNI GTAC 1 cut(s) 77
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 40
SinI GGWCC 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 71
Sse9I AATT 2 cut(s) 18, 188
SseBI AGGCCT 1 cut(s) 96
SsiI CCGC 1 cut(s) 50
StuI AGGCCT 1 cut(s) 96
TasI AATT 2 cut(s) 18, 188
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 1 cut(s) 50
VpaK11BI GGWCC 1 cut(s) 40
XapI RAATTY 1 cut(s) 18
Zsp2I ATGCAT 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.