Rw2G038440

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0001488
Physical Location & Seq
Forward (+)
63385241 .. 63386008
768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G038440.1

Sequence Viewer

Length: 177 bp
ATGACTCGTCTTTTGGTTATGGTACTTCTAAGACCATGGCGCTCTTTTAGTTTGGGAAATTGGAAAGGTAAAGAACACACATTTGTTATATCCAATGATGGAAGTGATGATGATCGGCTTGTTGAGTTGGTTCTGGCTCAGGGAATGAGGCATACTACTCACTGCATACTCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.71

Weight (kDa)

8.02

Isoelectric Point (pI)

19.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 24
ArsI GACNNNNNNTTYG 1 cut(s) 27
AspLEI GCGC 1 cut(s) 42
BccI CCATC 1 cut(s) 92
BfoI RGCGCY 1 cut(s) 43
Bpu10I CCTNAGC 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 35
Bse8I GATNNNNATC 1 cut(s) 111
BseDI CCNNGG 1 cut(s) 35
BseJI GATNNNNATC 1 cut(s) 111
BseMII CTCAG 1 cut(s) 152
Bsp143I GATC 1 cut(s) 112
Bsp19I CCATGG 1 cut(s) 35
BspCNI CTCAG 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 35
BstDEI CTNAG 2 cut(s) 29, 138
BstDSI CCRYGG 1 cut(s) 35
BstH2I RGCGCY 1 cut(s) 43
BstHHI GCGC 1 cut(s) 42
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BtgI CCRYGG 1 cut(s) 35
BtsI GCAGTG 1 cut(s) 160
BtsIMutI CAGTG 1 cut(s) 160
CfoI GCGC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 23
CviAII CATG 1 cut(s) 36
CviJI RGCY 2 cut(s) 118, 137
CviKI_1 RGCY 2 cut(s) 118, 137
CviQI GTAC 1 cut(s) 23
DdeI CTNAG 2 cut(s) 29, 138
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 35
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 1 cut(s) 39
FaiI YATR 7 cut(s) 20, 37, 89, 153, 167, 173, 175
FatI CATG 1 cut(s) 35
FauNDI CATATG 1 cut(s) 173
GlaI GCGC 1 cut(s) 41
HaeII RGCGCY 1 cut(s) 43
HhaI GCGC 1 cut(s) 42
Hin1II CATG 1 cut(s) 39
Hin6I GCGC 1 cut(s) 40
HinP1I GCGC 1 cut(s) 40
HinfI GANTC 1 cut(s) 4
HpyCH4V TGCA 1 cut(s) 165
HpyF3I CTNAG 2 cut(s) 29, 138
Hsp92II CATG 1 cut(s) 39
HspAI GCGC 1 cut(s) 40
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 119, 125
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MluCI AATT 1 cut(s) 58
MnlI CCTC 1 cut(s) 141
NcoI CCATGG 1 cut(s) 35
NdeI CATATG 1 cut(s) 173
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 39
RsaI GTAC 1 cut(s) 24
RsaNI GTAC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 112
SetI ASST 1 cut(s) 70
SgeI CNNG 5 cut(s) 18, 48, 131, 146, 152
Sse9I AATT 1 cut(s) 58
StyI CCWWGG 1 cut(s) 35
TasI AATT 1 cut(s) 58
TscAI CASTG 1 cut(s) 167
TspRI CASTG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.