Rroxscaffold_2G00116660

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0000736
Physical Location & Seq
Reverse (-)
43909507 .. 43911031
1525 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00116660.1

Sequence Viewer

Length: 195 bp
ATGTGCTCATTCGACAGTGGCAGAAAGAGCAAGGTCCAAAATTTGCACAAGTCTTCCGAGTGTTGCAAGATAACAAAGTTGTGGAGATTCAAACCGTATTTAACCACGACTCTTAAACATTACTTTGGTGATTTTTCTTTCTTCGAAGATTTCCAACACAGTGATCCCATTACTATATACATCTCCTTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.62

Weight (kDa)

8.88

Isoelectric Point (pI)

33.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 1 cut(s) 40
AgsI TTSAA 1 cut(s) 91
Alw21I GWGCWC 1 cut(s) 8
AlwI GGATC 1 cut(s) 158
ApoI RAATTY 1 cut(s) 40
AspS9I GGNCC 1 cut(s) 34
AsuHPI GGTGA 1 cut(s) 140
AsuII TTCGAA 1 cut(s) 144
AvaII GGWCC 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 45
Bbv12I GWGCWC 1 cut(s) 8
Bme18I GGWCC 1 cut(s) 34
BmgT120I GGNCC 1 cut(s) 34
BpiI GAAGAC 1 cut(s) 45
Bpu14I TTCGAA 1 cut(s) 144
BsiHKAI GWGCWC 1 cut(s) 8
Bsp119I TTCGAA 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 163
BspPI GGATC 1 cut(s) 158
BspT104I TTCGAA 1 cut(s) 144
BssMI GATC 1 cut(s) 163
Bst4CI ACNGT 3 cut(s) 17, 96, 161
BstBI TTCGAA 1 cut(s) 144
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstMWI GCNNNNNNNGC 1 cut(s) 27
BstV2I GAAGAC 1 cut(s) 45
BtsIMutI CAGTG 2 cut(s) 22, 166
Cfr13I GGNCC 1 cut(s) 34
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 34
FaiI YATR 2 cut(s) 176, 178
HinfI GANTC 2 cut(s) 87, 109
HphI GGTGA 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 192
HpyCH4III ACNGT 3 cut(s) 17, 96, 161
HpyCH4V TGCA 2 cut(s) 46, 66
HpyF10VI GCNNNNNNNGC 1 cut(s) 27
Kzo9I GATC 1 cut(s) 163
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 3 cut(s) 45, 133, 158
MhlI GDGCHC 1 cut(s) 8
MluCI AATT 1 cut(s) 40
MlyI GAGTC 1 cut(s) 103
MmeI TCCRAC 1 cut(s) 178
MseI TTAA 2 cut(s) 101, 114
MwoI GCNNNNNNNGC 1 cut(s) 27
NdeII GATC 1 cut(s) 163
NspV TTCGAA 1 cut(s) 144
PfeI GAWTC 1 cut(s) 87
PleI GAGTC 1 cut(s) 103
PpsI GAGTC 1 cut(s) 103
PspPI GGNCC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 101, 114
Sau3AI GATC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 34
SchI GAGTC 1 cut(s) 103
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 36
SfuI TTCGAA 1 cut(s) 144
SgeI CNNG 5 cut(s) 43, 61, 70, 79, 118
SinI GGWCC 1 cut(s) 34
Sse9I AATT 1 cut(s) 40
TaaI ACNGT 3 cut(s) 17, 96, 161
TaqI TCGA 2 cut(s) 12, 144
TasI AATT 1 cut(s) 40
TfiI GAWTC 1 cut(s) 87
Tru1I TTAA 2 cut(s) 101, 114
Tru9I TTAA 2 cut(s) 101, 114
TscAI CASTG 2 cut(s) 22, 166
TspRI CASTG 2 cut(s) 22, 166
VpaK11BI GGWCC 1 cut(s) 34
XapI RAATTY 1 cut(s) 40
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.