Rroxscaffold_6G00415270

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
37497792 .. 37501500
3709 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00415270.1

Sequence Viewer

Length: 168 bp
ATGACTCGTCTAGAACTCGCTCCTCGAAAATCCAAACTCGGCATCACTATTGCTACTTCCGTTGGTGTCCACCAACAAACCCTCGTTCTAAGTTGGAGAACGAGTCGAGAGATGGTGCCGACGATTTTGTTGAAGAATGAAATATTCAAGGCGTTGAGTTCGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.18

Weight (kDa)

10.42

Isoelectric Point (pI)

27.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 115
AgsI TTSAA 2 cut(s) 133, 148
BanI GGYRCC 1 cut(s) 115
BccI CCATC 1 cut(s) 106
BfaI CTAG 1 cut(s) 11
BmiI GGNNCC 1 cut(s) 117
BmsI GCATC 1 cut(s) 51
BsaXI ACNNNNNCTCC 2 cut(s) 88, 118
BseRI GAGGAG 1 cut(s) 12
BshNI GGYRCC 1 cut(s) 115
BspLI GGNNCC 1 cut(s) 117
BspT107I GGYRCC 1 cut(s) 115
BstDEI CTNAG 1 cut(s) 89
DdeI CTNAG 1 cut(s) 89
FspBI CTAG 1 cut(s) 11
HinfI GANTC 2 cut(s) 4, 103
Hpy166II GTNNAC 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 163
Hpy188III TCNNGA 2 cut(s) 11, 107
Hpy8I GTNNAC 1 cut(s) 70
Hpy99I CGWCG 1 cut(s) 124
HpyF3I CTNAG 1 cut(s) 89
LmnI GCTCC 1 cut(s) 25
LweI GCATC 1 cut(s) 51
MaeI CTAG 1 cut(s) 11
MboII GAAGA 1 cut(s) 145
MlyI GAGTC 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 74
MnlI CCTC 2 cut(s) 33, 92
NlaIV GGNNCC 1 cut(s) 117
NmeAIII GCCGAG 1 cut(s) 18
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 117
SchI GAGTC 1 cut(s) 112
SfaNI GCATC 1 cut(s) 51
SgeI CNNG 9 cut(s) 18, 23, 29, 36, 50, 95, 114, 119, 160
SspI AATATT 1 cut(s) 144
SspMI CTAG 1 cut(s) 11
TaqI TCGA 2 cut(s) 25, 106
TspDTI ATGAA 1 cut(s) 153
TspGWI ACGGA 1 cut(s) 49
XbaI TCTAGA 1 cut(s) 10
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.