Rh1CG355800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001150
Physical Location & Seq
Forward (+)
63041069 .. 63041243
175 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG355800.1

Sequence Viewer

Length: 175 bp
ATGGAGAGGAATGAGGAGAGGCTTCATACTAAACCAGATGTTTCTCGATTTCGTGTTGTTTGTCATTCATGGCGTCTCTCTGTTCCATACTACACGAAACAACAACTCTTTCCCTCAGTTAGTGGACATTACCTTCCACAGACGCCGTCTCGCCGAGAATGGGAGAGCTCTAGTG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

7.01

Weight (kDa)

9.51

Isoelectric Point (pI)

78.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 2 cut(s) 73, 143
AfiI CCNNNNNNNGG 1 cut(s) 160
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
Alw21I GWGCWC 1 cut(s) 170
Alw26I GTCTC 2 cut(s) 80, 153
BanII GRGCYC 1 cut(s) 170
Bbv12I GWGCWC 1 cut(s) 170
BceAI ACGGC 1 cut(s) 130
BcoDI GTCTC 2 cut(s) 80, 153
BfaI CTAG 1 cut(s) 171
BsaHI GRCGYC 2 cut(s) 73, 143
Bsc4I CCNNNNNNNGG 1 cut(s) 160
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 2 cut(s) 80, 153
BsmBI CGTCTC 2 cut(s) 80, 153
Bsp1286I GDGCHC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 128
BssNI GRCGYC 2 cut(s) 73, 143
BstACI GRCGYC 2 cut(s) 73, 143
BstDEI CTNAG 1 cut(s) 115
BstMAI GTCTC 2 cut(s) 80, 153
CseI GACGC 2 cut(s) 62, 151
CviAII CATG 1 cut(s) 69
CviJI RGCY 2 cut(s) 22, 168
CviKI_1 RGCY 2 cut(s) 22, 168
DdeI CTNAG 1 cut(s) 115
Ecl136II GAGCTC 1 cut(s) 168
Eco24I GRGCYC 1 cut(s) 170
Eco53kI GAGCTC 1 cut(s) 168
EcoICRI GAGCTC 1 cut(s) 168
EcoT38I GRGCYC 1 cut(s) 170
Esp3I CGTCTC 2 cut(s) 80, 153
FaeI CATG 1 cut(s) 72
FaiI YATR 3 cut(s) 27, 70, 88
FatI CATG 1 cut(s) 68
FriOI GRGCYC 1 cut(s) 170
FspBI CTAG 1 cut(s) 171
HgaI GACGC 2 cut(s) 62, 151
Hin1I GRCGYC 2 cut(s) 73, 143
Hin1II CATG 1 cut(s) 72
Hpy166II GTNNAC 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 45
Hpy8I GTNNAC 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 143
HpyF3I CTNAG 1 cut(s) 115
Hsp92I GRCGYC 2 cut(s) 73, 143
Hsp92II CATG 1 cut(s) 72
LpnPI CCDG 1 cut(s) 48
MaeI CTAG 1 cut(s) 171
MhlI GDGCHC 1 cut(s) 170
MnlI CCTC 3 cut(s) 7, 12, 124
NlaIII CATG 1 cut(s) 72
PflFI GACNNNGTC 1 cut(s) 145
Psp124BI GAGCTC 1 cut(s) 170
PsyI GACNNNGTC 1 cut(s) 145
SacI GAGCTC 1 cut(s) 170
SduI GDGCHC 1 cut(s) 170
SetI ASST 2 cut(s) 135, 170
SgeI CNNG 7 cut(s) 47, 57, 65, 81, 106, 162, 167
SspMI CTAG 1 cut(s) 171
SstI GAGCTC 1 cut(s) 170
TaqI TCGA 1 cut(s) 46
TspDTI ATGAA 2 cut(s) 14, 57
Tth111I GACNNNGTC 1 cut(s) 145
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.