Rh2DG115300

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
9512743 .. 9512934
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG115300.1

Sequence Viewer

Length: 192 bp
ATGGCGGATAGAGATCTCCCAGACGAGCTGATAGAGATGATCAGAAAGCACCTTGACCTTGGAACCAACATCTATGTTACTCAGTTCCGCGCCGTCTGTCAATATTGGCGATCTTCTATCCCTTCACTCAATCCACGCGAGCCACCACCTCAAGACCCTCTATTAGTCTATTACCCTCTAGATTTTACATAA

Protein Analysis

63

Amino Acids

7.45

Weight (kDa)

4.75

Isoelectric Point (pI)

41.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 90, 138
AciI CCGC 2 cut(s) 5, 88
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AspLEI GCGC 1 cut(s) 92
BceAI ACGGC 1 cut(s) 77
BclI TGATCA 1 cut(s) 39
BfaI CTAG 1 cut(s) 179
BglII AGATCT 1 cut(s) 13
BmiI GGNNCC 1 cut(s) 64
BpuEI CTTGAG 1 cut(s) 135
BsaBI GATNNNNATC 1 cut(s) 12
BsaJI CCNNGG 1 cut(s) 58
Bse8I GATNNNNATC 1 cut(s) 12
BseDI CCNNGG 1 cut(s) 58
BseJI GATNNNNATC 1 cut(s) 12
BseMII CTCAG 1 cut(s) 95
Bsh1236I CGCG 2 cut(s) 90, 138
Bsp143I GATC 3 cut(s) 13, 39, 110
BspACI CCGC 2 cut(s) 5, 88
BspCNI CTCAG 1 cut(s) 94
BspFNI CGCG 2 cut(s) 90, 138
BspLI GGNNCC 1 cut(s) 64
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 3 cut(s) 13, 39, 110
BssT1I CCWWGG 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 140
BstDEI CTNAG 1 cut(s) 81
BstFNI CGCG 2 cut(s) 90, 138
BstHHI GCGC 1 cut(s) 92
BstKTI GATC 3 cut(s) 16, 42, 113
BstMBI GATC 3 cut(s) 13, 39, 110
BstUI CGCG 2 cut(s) 90, 138
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
Cac8I GCNNGC 1 cut(s) 140
CfoI GCGC 1 cut(s) 92
CviJI RGCY 2 cut(s) 28, 142
CviKI_1 RGCY 2 cut(s) 28, 142
DdeI CTNAG 1 cut(s) 81
DpnI GATC 3 cut(s) 15, 41, 112
DpnII GATC 3 cut(s) 13, 39, 110
EciI GGCGGA 1 cut(s) 20
Eco130I CCWWGG 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 58
ErhI CCWWGG 1 cut(s) 58
FaiI YATR 2 cut(s) 75, 190
FbaI TGATCA 1 cut(s) 39
FspBI CTAG 1 cut(s) 179
GlaI GCGC 1 cut(s) 91
HhaI GCGC 1 cut(s) 92
Hin6I GCGC 1 cut(s) 90
HinP1I GCGC 1 cut(s) 90
Hpy188I TCNGA 1 cut(s) 44
Hpy188III TCNNGA 2 cut(s) 152, 179
HpyAV CCTTC 1 cut(s) 132
HpyF3I CTNAG 1 cut(s) 81
HspAI GCGC 1 cut(s) 90
Ksp22I TGATCA 1 cut(s) 39
Kzo9I GATC 3 cut(s) 13, 39, 110
LpnPI CCDG 1 cut(s) 33
MaeI CTAG 1 cut(s) 179
MaeIII GTNAC 1 cut(s) 76
MalI GATC 3 cut(s) 15, 41, 112
MboI GATC 3 cut(s) 13, 39, 110
MboII GAAGA 1 cut(s) 105
MflI RGATCY 1 cut(s) 13
MnlI CCTC 3 cut(s) 159, 168, 186
MvnI CGCG 2 cut(s) 90, 138
NdeII GATC 3 cut(s) 13, 39, 110
NlaIV GGNNCC 1 cut(s) 64
PspN4I GGNNCC 1 cut(s) 64
PsuI RGATCY 1 cut(s) 13
Sau3AI GATC 3 cut(s) 13, 39, 110
SetI ASST 4 cut(s) 30, 54, 60, 151
SgeI CNNG 9 cut(s) 32, 37, 65, 71, 101, 147, 149, 151, 164
SmlI CTYRAG 1 cut(s) 150
SmoI CTYRAG 1 cut(s) 150
SsiI CCGC 2 cut(s) 5, 88
SspI AATATT 1 cut(s) 104
SspMI CTAG 1 cut(s) 179
StyI CCWWGG 1 cut(s) 58
XbaI TCTAGA 1 cut(s) 178
XspI CTAG 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.