AT2G31953

Belongs to the DEFL family

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
2
Physical Location & Seq
Forward (+)
13583376 .. 13584020
645 bp
Loading structure...
UTR
Exon/CDS
Intron
AT2G31953.1

Sequence Viewer

Length: 261 bp
ATGAAGAGCTCTATGCAGTTAATCTCTACACTCTTCTTCCTAGTCATACTTGTTGTCGCACCAGGTATGAAGATGGTTGTTGAAGGACAACCACAATTGTGCGAAACGAAAAGCTTAAACTACAGGGGGTTGTGCTTGAAATGGAGGAGTTGCAAGCGAGTATGTATTAGCGAAGGTTTCCCTGATGGTCGATGCAAAGGATTCTTCAACAACAAATGTGTTTGCAGGAAGCCTTGTGCTCTTCTTTCTACCGAAAACTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.68

Weight (kDa)

9.32

Isoelectric Point (pI)

39.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Gamma-thionin PF00304 32 - 79 2.3e-15 Gamma-thionin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 83, 139, 208
AjnI CCWGG 1 cut(s) 61
AleI CACNNNNGTG 1 cut(s) 97
AluBI AGCT 2 cut(s) 9, 114
AluI AGCT 2 cut(s) 9, 114
Alw21I GWGCWC 2 cut(s) 11, 241
BanII GRGCYC 1 cut(s) 11
Bbv12I GWGCWC 2 cut(s) 11, 241
BccI CCATC 2 cut(s) 67, 179
BciT130I CCWGG 1 cut(s) 63
BfaI CTAG 2 cut(s) 41, 259
BfmI CTRYAG 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 63
BmrFI CCNGG 1 cut(s) 63
BmsI GCATC 1 cut(s) 182
BseBI CCWGG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 160
BsiHKAI GWGCWC 2 cut(s) 11, 241
Bsp1286I GDGCHC 2 cut(s) 11, 241
BspQI GCTCTTC 1 cut(s) 246
Bst2UI CCWGG 1 cut(s) 63
Bst6I CTCTTC 2 cut(s) 38, 246
BstC8I GCNNGC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 63
BstSCI CCNGG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 121
Cac8I GCNNGC 1 cut(s) 155
CsiI ACCWGGT 1 cut(s) 61
CviJI RGCY 3 cut(s) 9, 114, 232
CviKI_1 RGCY 3 cut(s) 9, 114, 232
Eam1104I CTCTTC 2 cut(s) 38, 246
EarI CTCTTC 2 cut(s) 38, 246
Ecl136II GAGCTC 1 cut(s) 9
Eco24I GRGCYC 1 cut(s) 11
Eco53kI GAGCTC 1 cut(s) 9
EcoICRI GAGCTC 1 cut(s) 9
EcoRII CCWGG 1 cut(s) 61
EcoT38I GRGCYC 1 cut(s) 11
FaiI YATR 4 cut(s) 14, 47, 68, 163
FriOI GRGCYC 1 cut(s) 11
FspBI CTAG 2 cut(s) 41, 259
HindIII AAGCTT 1 cut(s) 112
HinfI GANTC 1 cut(s) 201
HpyAV CCTTC 2 cut(s) 77, 167
HpyCH4V TGCA 4 cut(s) 16, 153, 195, 225
LguI GCTCTTC 1 cut(s) 246
LpnPI CCDG 5 cut(s) 48, 75, 109, 195, 211
LweI GCATC 1 cut(s) 182
MabI ACCWGGT 1 cut(s) 61
MaeI CTAG 2 cut(s) 41, 259
MboII GAAGA 6 cut(s) 16, 25, 28, 82, 196, 233
MfeI CAATTG 1 cut(s) 95
MhlI GDGCHC 2 cut(s) 11, 241
MluCI AATT 1 cut(s) 95
MnlI CCTC 1 cut(s) 138
MseI TTAA 2 cut(s) 20, 116
MslI CAYNNNNRTG 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 63
MunI CAATTG 1 cut(s) 95
MvaI CCWGG 1 cut(s) 63
OliI CACNNNNGTG 1 cut(s) 97
PciSI GCTCTTC 1 cut(s) 246
PfeI GAWTC 1 cut(s) 201
Psp124BI GAGCTC 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 61
PspGI CCWGG 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 97
SacI GAGCTC 1 cut(s) 11
SapI GCTCTTC 1 cut(s) 246
SaqAI TTAA 2 cut(s) 20, 116
ScrFI CCNGG 1 cut(s) 63
SduI GDGCHC 2 cut(s) 11, 241
SetI ASST 4 cut(s) 11, 67, 116, 178
SexAI ACCWGGT 1 cut(s) 61
SfaNI GCATC 1 cut(s) 182
SfcI CTRYAG 1 cut(s) 121
SmiMI CAYNNNNRTG 1 cut(s) 97
Sse9I AATT 1 cut(s) 95
SspMI CTAG 2 cut(s) 41, 259
SstI GAGCTC 1 cut(s) 11
StyD4I CCNGG 1 cut(s) 61
TaqI TCGA 1 cut(s) 190
TasI AATT 1 cut(s) 95
TfiI GAWTC 1 cut(s) 201
Tru1I TTAA 2 cut(s) 20, 116
Tru9I TTAA 2 cut(s) 20, 116
TspDTI ATGAA 2 cut(s) 17, 83
XspI CTAG 2 cut(s) 41, 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.